EMAIL THIS PAGE TO A FRIEND

C9orf129

chromosome 9 open reading frame 129

14 Gene Product Result for
Synonyms: bA165J3.3
Species: Human C9orf129(445577)
UniProtKB ID: Q5T035
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098808 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118281 MISSION® esiRNA esiRNA human C9orf129 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098808 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319954 predicted 866
2 SASI_Hs02_00319955 predicted 527
3 SASI_Hs02_00319956 predicted 871
4 SASI_Hs02_00319957 predicted 658
5 SASI_Hs02_00319958 predicted 379
6 SASI_Hs02_00319959 predicted 558
7 SASI_Hs02_00319960 predicted 822
8 SASI_Hs02_00319961 predicted 752
9 SASI_Hs02_00319962 predicted 588
10 SASI_Hs02_00319963 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098808
C9orf129 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 129
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-755s21c1
Sequence:CCGGGCCACTGACCACCATGTACAACTCGAGTTGTACATGGTGGTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098808.1-968s21c1
Sequence:CCGGGGCACTCTACTGAGGACAAAGCTCGAGCTTTGTCCTCAGTAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-875s21c1
Sequence:CCGGCAACTGACATTCCCTACTGAGCTCGAGCTCAGTAGGGAATGTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-825s21c1
Sequence:CCGGATGTCTGCTCACCTAACGTTTCTCGAGAAACGTTAGGTGAGCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-770s21c1
Sequence:CCGGGTACAAGGAAGGGATTCACAGCTCGAGCTGTGAATCCCTTCCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098808
C9orf129 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 129
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-755s21c1
Sequence:CCGGGCCACTGACCACCATGTACAACTCGAGTTGTACATGGTGGTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098808.1-968s21c1
Sequence:CCGGGGCACTCTACTGAGGACAAAGCTCGAGCTTTGTCCTCAGTAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-875s21c1
Sequence:CCGGCAACTGACATTCCCTACTGAGCTCGAGCTCAGTAGGGAATGTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-825s21c1
Sequence:CCGGATGTCTGCTCACCTAACGTTTCTCGAGAAACGTTAGGTGAGCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-770s21c1
Sequence:CCGGGTACAAGGAAGGGATTCACAGCTCGAGCTGTGAATCCCTTCCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098808
C9orf129 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 129
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-755s21c1
Sequence:CCGGGCCACTGACCACCATGTACAACTCGAGTTGTACATGGTGGTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098808.1-968s21c1
Sequence:CCGGGGCACTCTACTGAGGACAAAGCTCGAGCTTTGTCCTCAGTAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-875s21c1
Sequence:CCGGCAACTGACATTCCCTACTGAGCTCGAGCTCAGTAGGGAATGTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-825s21c1
Sequence:CCGGATGTCTGCTCACCTAACGTTTCTCGAGAAACGTTAGGTGAGCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098808.1-770s21c1
Sequence:CCGGGTACAAGGAAGGGATTCACAGCTCGAGCTGTGAATCCCTTCCTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks