EMAIL THIS PAGE TO A FRIEND

C9orf131

chromosome 9 open reading frame 131

54 Gene Product Result for
Species: Human C9orf131(138724)
UniProtKB ID: Q5VYM1, A6NLE6, E9PB26, Q86XC6, Q9UF74
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203299 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054911 MISSION® esiRNA esiRNA human C9orf131 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040410 Rosetta Predictions human pricing
NM_001040411 Rosetta Predictions human pricing
NM_001040412 Rosetta Predictions human pricing
NM_203299 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060104 predicted 1538
2 SASI_Hs01_00060105 predicted 1659
3 SASI_Hs01_00060106 predicted 860
4 SASI_Hs02_00308945 predicted 2275
5 SASI_Hs01_00060107 predicted 2771
6 SASI_Hs01_00060108 predicted 1776
7 SASI_Hs01_00060109 predicted 686
8 SASI_Hs02_00308946 predicted 1776
9 SASI_Hs01_00060110 predicted 2441
10 SASI_Hs01_00060111 predicted 874
11 SASI_Hs01_00060112 predicted 1553
12 SASI_Hs01_00060113 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029508 predicted 1437
2 SASI_Hs01_00029509 predicted 1558
3 SASI_Hs01_00029510 predicted 756
4 SASI_Hs02_00308947 predicted 2176
5 SASI_Hs01_00029511 predicted 2672
6 SASI_Hs01_00029512 predicted 1679
7 SASI_Hs01_00029513 predicted 590
8 SASI_Hs02_00308948 predicted 1677
9 SASI_Hs01_00029514 predicted 2336
10 SASI_Hs01_00029515 predicted 769
11 SASI_Hs01_00029516 predicted 1450
12 SASI_Hs01_00029517 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074763 predicted 1505
2 SASI_Hs01_00074764 predicted 1637
3 SASI_Hs01_00074765 predicted 835
4 SASI_Hs02_00308949 predicted 2256
5 SASI_Hs01_00074766 predicted 2746
6 SASI_Hs01_00074767 predicted 1750
7 SASI_Hs01_00074768 predicted 658
8 SASI_Hs02_00308950 predicted 1747
9 SASI_Hs01_00074769 predicted 2409
10 SASI_Hs01_00074770 predicted 846
11 SASI_Hs01_00074771 predicted 1525
12 SASI_Hs01_00074772 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168981 predicted 1644
2 SASI_Hs01_00168982 predicted 1767
3 SASI_Hs01_00168983 predicted 969
4 SASI_Hs02_00373229 predicted 2385
5 SASI_Hs01_00168984 predicted 2880
6 SASI_Hs01_00168985 predicted 1886
7 SASI_Hs01_00168986 predicted 791
8 SASI_Hs02_00373230 predicted 1882
9 SASI_Hs01_00168987 predicted 2548
10 SASI_Hs01_00168988 predicted 973
11 SASI_Hs01_00168989 predicted 1658
12 SASI_Hs01_00168990 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203299
C9orf131 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 131
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-2384s1c1
Sequence:CCGGGCTGAAACTCAGGCTGAAGAACTCGAGTTCTTCAGCCTGAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-681s1c1
Sequence:CCGGCCTCTGAAGTTGTCTGTTTGTCTCGAGACAAACAGACAACTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-1642s1c1
Sequence:CCGGCAGAAGCTACATGGAAGGATACTCGAGTATCCTTCCATGTAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-710s1c1
Sequence:CCGGCTTCTTCAACAAGCTTGCCTTCTCGAGAAGGCAAGCTTGTTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-380s1c1
Sequence:CCGGGCCATGTTCTCCTACCAAAGACTCGAGTCTTTGGTAGGAGAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-1508s1c1
Sequence:CCGGCAAAGCTTTGTGGGAGACCATCTCGAGATGGTCTCCCACAAAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-141s1c1
Sequence:CCGGCCAGGAAATCTGGTGACACTACTCGAGTAGTGTCACCAGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-2228s1c1
Sequence:CCGGCCTAGCTGAAGCTGTGAAGATCTCGAGATCTTCACAGCTTCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-2232s1c1
Sequence:CCGGGCTGAAGCTGTGAAGATTGAACTCGAGTTCAATCTTCACAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203299
C9orf131 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 131
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-2384s1c1
Sequence:CCGGGCTGAAACTCAGGCTGAAGAACTCGAGTTCTTCAGCCTGAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-681s1c1
Sequence:CCGGCCTCTGAAGTTGTCTGTTTGTCTCGAGACAAACAGACAACTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-1642s1c1
Sequence:CCGGCAGAAGCTACATGGAAGGATACTCGAGTATCCTTCCATGTAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-710s1c1
Sequence:CCGGCTTCTTCAACAAGCTTGCCTTCTCGAGAAGGCAAGCTTGTTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-380s1c1
Sequence:CCGGGCCATGTTCTCCTACCAAAGACTCGAGTCTTTGGTAGGAGAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-1508s1c1
Sequence:CCGGCAAAGCTTTGTGGGAGACCATCTCGAGATGGTCTCCCACAAAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-141s1c1
Sequence:CCGGCCAGGAAATCTGGTGACACTACTCGAGTAGTGTCACCAGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-2228s1c1
Sequence:CCGGCCTAGCTGAAGCTGTGAAGATCTCGAGATCTTCACAGCTTCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-2232s1c1
Sequence:CCGGGCTGAAGCTGTGAAGATTGAACTCGAGTTCAATCTTCACAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203299
C9orf131 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 131
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-2384s1c1
Sequence:CCGGGCTGAAACTCAGGCTGAAGAACTCGAGTTCTTCAGCCTGAGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-681s1c1
Sequence:CCGGCCTCTGAAGTTGTCTGTTTGTCTCGAGACAAACAGACAACTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-1642s1c1
Sequence:CCGGCAGAAGCTACATGGAAGGATACTCGAGTATCCTTCCATGTAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-710s1c1
Sequence:CCGGCTTCTTCAACAAGCTTGCCTTCTCGAGAAGGCAAGCTTGTTGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-380s1c1
Sequence:CCGGGCCATGTTCTCCTACCAAAGACTCGAGTCTTTGGTAGGAGAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-1508s1c1
Sequence:CCGGCAAAGCTTTGTGGGAGACCATCTCGAGATGGTCTCCCACAAAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-141s1c1
Sequence:CCGGCCAGGAAATCTGGTGACACTACTCGAGTAGTGTCACCAGATTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203299.1-2228s1c1
Sequence:CCGGCCTAGCTGAAGCTGTGAAGATCTCGAGATCTTCACAGCTTCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203299.1-2232s1c1
Sequence:CCGGGCTGAAGCTGTGAAGATTGAACTCGAGTTCAATCTTCACAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks