EMAIL THIS PAGE TO A FRIEND

C9orf135

chromosome 9 open reading frame 135

30 Gene Product Result for
Species: Human C9orf135(138255)
UniProtKB ID: Q5VTT2, B2RN61
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010940 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102661 MISSION® esiRNA esiRNA human C9orf135 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010940 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074273 predicted 571
2 SASI_Hs01_00074274 predicted 529
3 SASI_Hs01_00074275 predicted 621
4 SASI_Hs01_00074276 predicted 517
5 SASI_Hs01_00074277 predicted 244
6 SASI_Hs01_00074278 predicted 611
7 SASI_Hs01_00074280 predicted 431
8 SASI_Hs02_00305934 predicted 447
9 SASI_Hs01_00074282 predicted 330
10 SASI_Hs02_00305935 predicted 516
11 SASI_Hs01_00074279 predicted 452
12 SASI_Hs01_00074281 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010940
C9orf135 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 135
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-107s1c1
Sequence:CCGGGAAGCAACACTGGTTGGAGATCTCGAGATCTCCAACCAGTGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-618s1c1
Sequence:CCGGCGTTCTCAGTTCACGGATCTACTCGAGTAGATCCGTGAACTGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-185s1c1
Sequence:CCGGGAAATACTCGAAGCCGGTGTTCTCGAGAACACCGGCTTCGAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-477s1c1
Sequence:CCGGGCTGTCTTTCCTAGACATCCACTCGAGTGGATGTCTAGGAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-182s1c1
Sequence:CCGGCAAGAAATACTCGAAGCCGGTCTCGAGACCGGCTTCGAGTATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-524s1c1
Sequence:CCGGGACAACGTACTCAGAAGATTACTCGAGTAATCTTCTGAGTACGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-176s1c1
Sequence:CCGGCCATCACAAGAAATACTCGAACTCGAGTTCGAGTATTTCTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-580s1c1
Sequence:CCGGCCTGTCAAGATGATTATTCCACTCGAGTGGAATAATCATCTTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-535s1c1
Sequence:CCGGCAGAAGATTATGTTCCACCATCTCGAGATGGTGGAACATAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-398s1c1
Sequence:CCGGCAAGGCTTTATTGAATGAGGACTCGAGTCCTCATTCAATAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-552s1c1
Sequence:CCGGCCATATGATTATCAGCCACATCTCGAGATGTGGCTGATAATCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-671s1c1
Sequence:CCGGGCATGATGAGAGTGGGATTTACTCGAGTAAATCCCACTCTCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010940
C9orf135 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 135
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-107s1c1
Sequence:CCGGGAAGCAACACTGGTTGGAGATCTCGAGATCTCCAACCAGTGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-618s1c1
Sequence:CCGGCGTTCTCAGTTCACGGATCTACTCGAGTAGATCCGTGAACTGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-185s1c1
Sequence:CCGGGAAATACTCGAAGCCGGTGTTCTCGAGAACACCGGCTTCGAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-477s1c1
Sequence:CCGGGCTGTCTTTCCTAGACATCCACTCGAGTGGATGTCTAGGAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-182s1c1
Sequence:CCGGCAAGAAATACTCGAAGCCGGTCTCGAGACCGGCTTCGAGTATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-524s1c1
Sequence:CCGGGACAACGTACTCAGAAGATTACTCGAGTAATCTTCTGAGTACGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-176s1c1
Sequence:CCGGCCATCACAAGAAATACTCGAACTCGAGTTCGAGTATTTCTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-580s1c1
Sequence:CCGGCCTGTCAAGATGATTATTCCACTCGAGTGGAATAATCATCTTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-535s1c1
Sequence:CCGGCAGAAGATTATGTTCCACCATCTCGAGATGGTGGAACATAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-398s1c1
Sequence:CCGGCAAGGCTTTATTGAATGAGGACTCGAGTCCTCATTCAATAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-552s1c1
Sequence:CCGGCCATATGATTATCAGCCACATCTCGAGATGTGGCTGATAATCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-671s1c1
Sequence:CCGGGCATGATGAGAGTGGGATTTACTCGAGTAAATCCCACTCTCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010940
C9orf135 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 135
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-107s1c1
Sequence:CCGGGAAGCAACACTGGTTGGAGATCTCGAGATCTCCAACCAGTGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-618s1c1
Sequence:CCGGCGTTCTCAGTTCACGGATCTACTCGAGTAGATCCGTGAACTGAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-185s1c1
Sequence:CCGGGAAATACTCGAAGCCGGTGTTCTCGAGAACACCGGCTTCGAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-477s1c1
Sequence:CCGGGCTGTCTTTCCTAGACATCCACTCGAGTGGATGTCTAGGAAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-182s1c1
Sequence:CCGGCAAGAAATACTCGAAGCCGGTCTCGAGACCGGCTTCGAGTATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-524s1c1
Sequence:CCGGGACAACGTACTCAGAAGATTACTCGAGTAATCTTCTGAGTACGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-176s1c1
Sequence:CCGGCCATCACAAGAAATACTCGAACTCGAGTTCGAGTATTTCTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-580s1c1
Sequence:CCGGCCTGTCAAGATGATTATTCCACTCGAGTGGAATAATCATCTTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-535s1c1
Sequence:CCGGCAGAAGATTATGTTCCACCATCTCGAGATGGTGGAACATAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010940.1-398s1c1
Sequence:CCGGCAAGGCTTTATTGAATGAGGACTCGAGTCCTCATTCAATAAAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-552s1c1
Sequence:CCGGCCATATGATTATCAGCCACATCTCGAGATGTGGCTGATAATCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010940.1-671s1c1
Sequence:CCGGGCATGATGAGAGTGGGATTTACTCGAGTAAATCCCACTCTCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks