EMAIL THIS PAGE TO A FRIEND

C9orf139

chromosome 9 open reading frame 139

Species: Human C9orf139(401563)
UniProtKB ID: Q6ZV77, A2RUA3, B9EGW2, Q5SPY0, Q8N224
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207511 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147671 MISSION® esiRNA esiRNA human C9orf139 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207511 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152673 predicted 2388
2 SASI_Hs01_00152674 predicted 1916
3 SASI_Hs01_00152675 predicted 1660
4 SASI_Hs01_00152676 predicted 2483
5 SASI_Hs01_00152678 predicted 2487
6 SASI_Hs01_00152679 predicted 2135
7 SASI_Hs01_00152680 predicted 2127
8 SASI_Hs01_00152681 predicted 2492
9 SASI_Hs01_00152682 predicted 2384
10 SASI_Hs02_00374141 predicted 1938
11 SASI_Hs01_00152677 predicted 2205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207511
C9orf139 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 139
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1665s1c1
Sequence:CCGGCTGGAGATCTCAATGCAGACACTCGAGTGTCTGCATTGAGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3521s1c1
Sequence:CCGGCAGGGACCAATGAAAGCCAAACTCGAGTTTGGCTTTCATTGGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1977s1c1
Sequence:CCGGCCAGAAATGGGTCAGAACGAACTCGAGTTCGTTCTGACCCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1995s1c1
Sequence:CCGGGAAAGCCTCTCAGAGGAAAGACTCGAGTCTTTCCTCTGAGAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-2137s1c1
Sequence:CCGGGTGTGTGAGCATCGTGATGATCTCGAGATCATCACGATGCTCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3261s1c1
Sequence:CCGGCCAAGGTGAAATCTGCCTCTTCTCGAGAAGAGGCAGATTTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1978s1c1
Sequence:CCGGCAGAAATGGGTCAGAACGAAACTCGAGTTTCGTTCTGACCCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3321s1c1
Sequence:CCGGGAAGGTAAAGTGGAAAGGAATCTCGAGATTCCTTTCCACTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3316s1c1
Sequence:CCGGCAGCAGAAGGTAAAGTGGAAACTCGAGTTTCCACTTTACCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-2021s1c1
Sequence:CCGGGCATGAGTCAAAGAGAAAGTCCTCGAGGACTTTCTCTTTGACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-2489s1c1
Sequence:CCGGGACTGCCCTTATTCTCAGTAACTCGAGTTACTGAGAATAAGGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3262s1c1
Sequence:CCGGCAAGGTGAAATCTGCCTCTTACTCGAGTAAGAGGCAGATTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3550s1c1
Sequence:CCGGGTGGTGGCTTATGCCTGTAATCTCGAGATTACAGGCATAAGCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165229    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3251s1c1
Sequence:CCGGGAGCCAGAAACCAAGGTGAAACTCGAGTTTCACCTTGGTTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3308s1c1
Sequence:CCGGGACAGGAACAGCAGAAGGTAACTCGAGTTACCTTCTGCTGTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207511
C9orf139 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 139
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1665s1c1
Sequence:CCGGCTGGAGATCTCAATGCAGACACTCGAGTGTCTGCATTGAGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3521s1c1
Sequence:CCGGCAGGGACCAATGAAAGCCAAACTCGAGTTTGGCTTTCATTGGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1977s1c1
Sequence:CCGGCCAGAAATGGGTCAGAACGAACTCGAGTTCGTTCTGACCCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1995s1c1
Sequence:CCGGGAAAGCCTCTCAGAGGAAAGACTCGAGTCTTTCCTCTGAGAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-2137s1c1
Sequence:CCGGGTGTGTGAGCATCGTGATGATCTCGAGATCATCACGATGCTCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3261s1c1
Sequence:CCGGCCAAGGTGAAATCTGCCTCTTCTCGAGAAGAGGCAGATTTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1978s1c1
Sequence:CCGGCAGAAATGGGTCAGAACGAAACTCGAGTTTCGTTCTGACCCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3321s1c1
Sequence:CCGGGAAGGTAAAGTGGAAAGGAATCTCGAGATTCCTTTCCACTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3316s1c1
Sequence:CCGGCAGCAGAAGGTAAAGTGGAAACTCGAGTTTCCACTTTACCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-2021s1c1
Sequence:CCGGGCATGAGTCAAAGAGAAAGTCCTCGAGGACTTTCTCTTTGACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-2489s1c1
Sequence:CCGGGACTGCCCTTATTCTCAGTAACTCGAGTTACTGAGAATAAGGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3262s1c1
Sequence:CCGGCAAGGTGAAATCTGCCTCTTACTCGAGTAAGAGGCAGATTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3550s1c1
Sequence:CCGGGTGGTGGCTTATGCCTGTAATCTCGAGATTACAGGCATAAGCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165229    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3251s1c1
Sequence:CCGGGAGCCAGAAACCAAGGTGAAACTCGAGTTTCACCTTGGTTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3308s1c1
Sequence:CCGGGACAGGAACAGCAGAAGGTAACTCGAGTTACCTTCTGCTGTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207511
C9orf139 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 139
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1665s1c1
Sequence:CCGGCTGGAGATCTCAATGCAGACACTCGAGTGTCTGCATTGAGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3521s1c1
Sequence:CCGGCAGGGACCAATGAAAGCCAAACTCGAGTTTGGCTTTCATTGGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1977s1c1
Sequence:CCGGCCAGAAATGGGTCAGAACGAACTCGAGTTCGTTCTGACCCATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1995s1c1
Sequence:CCGGGAAAGCCTCTCAGAGGAAAGACTCGAGTCTTTCCTCTGAGAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-2137s1c1
Sequence:CCGGGTGTGTGAGCATCGTGATGATCTCGAGATCATCACGATGCTCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3261s1c1
Sequence:CCGGCCAAGGTGAAATCTGCCTCTTCTCGAGAAGAGGCAGATTTCACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-1978s1c1
Sequence:CCGGCAGAAATGGGTCAGAACGAAACTCGAGTTTCGTTCTGACCCATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3321s1c1
Sequence:CCGGGAAGGTAAAGTGGAAAGGAATCTCGAGATTCCTTTCCACTTTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3316s1c1
Sequence:CCGGCAGCAGAAGGTAAAGTGGAAACTCGAGTTTCCACTTTACCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207511.1-2021s1c1
Sequence:CCGGGCATGAGTCAAAGAGAAAGTCCTCGAGGACTTTCTCTTTGACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-2489s1c1
Sequence:CCGGGACTGCCCTTATTCTCAGTAACTCGAGTTACTGAGAATAAGGGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3262s1c1
Sequence:CCGGCAAGGTGAAATCTGCCTCTTACTCGAGTAAGAGGCAGATTTCACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3550s1c1
Sequence:CCGGGTGGTGGCTTATGCCTGTAATCTCGAGATTACAGGCATAAGCCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165229    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3251s1c1
Sequence:CCGGGAGCCAGAAACCAAGGTGAAACTCGAGTTTCACCTTGGTTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207511.1-3308s1c1
Sequence:CCGGGACAGGAACAGCAGAAGGTAACTCGAGTTACCTTCTGCTGTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks