EMAIL THIS PAGE TO A FRIEND

C9orf142

chromosome 9 open reading frame 142

18 Gene Product Result for
Species: Human C9orf142(286257)
UniProtKB ID: Q9BUH6, Q8IY19
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045268 Anti-C9orf142 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183241 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027071 MISSION® esiRNA esiRNA human C9orf142 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183241 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035325 predicted 587
2 SASI_Hs01_00035326 predicted 433
3 SASI_Hs02_00371249 predicted 453
4 SASI_Hs01_00035327 predicted 556
5 SASI_Hs01_00035329 predicted 218
6 SASI_Hs01_00035330 predicted 327
7 SASI_Hs02_00371250 predicted 240
8 SASI_Hs01_00035331 predicted 258
9 SASI_Hs01_00035332 predicted 381
10 SASI_Hs01_00035333 predicted 493
11 SASI_Hs01_00035328 predicted 494
12 SASI_Hs01_00035334 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183241
VALIDATED
C9orf142 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 142
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183241.1-589s21c1
Sequence:CCGGCCGGGTTCAAGAGTAAGAAACCTCGAGGTTTCTTACTCTTGAACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-622s21c1
Sequence:CCGGTGGACTTCGATGAGACCTGAACTCGAGTTCAGGTCTCATCGAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183241.1-566s21c1
Sequence:CCGGTCCAGGAGAGTCGCTCATCAACTCGAGTTGATGAGCGACTCTCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-301s21c1
Sequence:CCGGACAGAGCATCCCTGACGCTTTCTCGAGAAAGCGTCAGGGATGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-504s21c1
Sequence:CCGGCTCTTCTTACCAGACCCAGATCTCGAGATCTGGGTCTGGTAAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183241
VALIDATED
C9orf142 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 142
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183241.1-589s21c1
Sequence:CCGGCCGGGTTCAAGAGTAAGAAACCTCGAGGTTTCTTACTCTTGAACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-622s21c1
Sequence:CCGGTGGACTTCGATGAGACCTGAACTCGAGTTCAGGTCTCATCGAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183241.1-566s21c1
Sequence:CCGGTCCAGGAGAGTCGCTCATCAACTCGAGTTGATGAGCGACTCTCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-301s21c1
Sequence:CCGGACAGAGCATCCCTGACGCTTTCTCGAGAAAGCGTCAGGGATGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-504s21c1
Sequence:CCGGCTCTTCTTACCAGACCCAGATCTCGAGATCTGGGTCTGGTAAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183241
VALIDATED
C9orf142 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 142
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183241.1-589s21c1
Sequence:CCGGCCGGGTTCAAGAGTAAGAAACCTCGAGGTTTCTTACTCTTGAACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-622s21c1
Sequence:CCGGTGGACTTCGATGAGACCTGAACTCGAGTTCAGGTCTCATCGAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183241.1-566s21c1
Sequence:CCGGTCCAGGAGAGTCGCTCATCAACTCGAGTTGATGAGCGACTCTCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-301s21c1
Sequence:CCGGACAGAGCATCCCTGACGCTTTCTCGAGAAAGCGTCAGGGATGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_183241.1-504s21c1
Sequence:CCGGCTCTTCTTACCAGACCCAGATCTCGAGATCTGGGTCTGGTAAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)