EMAIL THIS PAGE TO A FRIEND

C9orf152

chromosome 9 open reading frame 152

Synonyms: bA470J20.2
UniProtKB ID: Q5JTZ5, A8MWT6
Gene ID:
chicken(770400) chromosome 2 open reading frame, human C9orf152
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012993 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039651 MISSION® esiRNA esiRNA human C9orf152 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012993 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123170 predicted 777
2 SASI_Hs01_00123171 predicted 1711
3 SASI_Hs01_00123172 predicted 1361
4 SASI_Hs01_00123173 predicted 1183
5 SASI_Hs01_00123174 predicted 1379
6 SASI_Hs01_00123175 predicted 1682
7 SASI_Hs01_00123176 predicted 1108
8 SASI_Hs02_00306314 predicted 784
9 SASI_Hs01_00123177 predicted 1458
10 SASI_Hs01_00123178 predicted 1251
11 SASI_Hs01_00123169 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012993
C9orf152 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 152
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012993.2-1148s21c1
Sequence:CCGGTCAATGTCCTCTTTCCATAAACTCGAGTTTATGGAAAGAGGACATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012993.2-1682s21c1
Sequence:CCGGTTCAATGTCTTCTGATGATTTCTCGAGAAATCATCAGAAGACATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-186s1c1
Sequence:CCGGCCCAGTATGAAGGCTTGAAGACTCGAGTCTTCAAGCCTTCATACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-283s1c1
Sequence:CCGGCAATGCTGTTTGGATTAACAACTCGAGTTGTTAATCCAAACAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012993.1-1737s1c1
Sequence:CCGGGCCTCCTGTTTAGTCCAACTTCTCGAGAAGTTGGACTAAACAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012993.1-609s1c1
Sequence:CCGGCCCAAACAAAGGCAGTGGAATCTCGAGATTCCACTGCCTTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-688s1c1
Sequence:CCGGCAAACCAGCTTACTATCCATTCTCGAGAATGGATAGTAAGCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-301s1c1
Sequence:CCGGCAAGGAGAGAAGAAGCTCACTCTCGAGAGTGAGCTTCTTCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012993
C9orf152 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 152
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012993.2-1148s21c1
Sequence:CCGGTCAATGTCCTCTTTCCATAAACTCGAGTTTATGGAAAGAGGACATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012993.2-1682s21c1
Sequence:CCGGTTCAATGTCTTCTGATGATTTCTCGAGAAATCATCAGAAGACATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-186s1c1
Sequence:CCGGCCCAGTATGAAGGCTTGAAGACTCGAGTCTTCAAGCCTTCATACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-283s1c1
Sequence:CCGGCAATGCTGTTTGGATTAACAACTCGAGTTGTTAATCCAAACAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012993.1-1737s1c1
Sequence:CCGGGCCTCCTGTTTAGTCCAACTTCTCGAGAAGTTGGACTAAACAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012993.1-609s1c1
Sequence:CCGGCCCAAACAAAGGCAGTGGAATCTCGAGATTCCACTGCCTTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-688s1c1
Sequence:CCGGCAAACCAGCTTACTATCCATTCTCGAGAATGGATAGTAAGCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-301s1c1
Sequence:CCGGCAAGGAGAGAAGAAGCTCACTCTCGAGAGTGAGCTTCTTCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012993
C9orf152 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 152
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012993.2-1148s21c1
Sequence:CCGGTCAATGTCCTCTTTCCATAAACTCGAGTTTATGGAAAGAGGACATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012993.2-1682s21c1
Sequence:CCGGTTCAATGTCTTCTGATGATTTCTCGAGAAATCATCAGAAGACATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-186s1c1
Sequence:CCGGCCCAGTATGAAGGCTTGAAGACTCGAGTCTTCAAGCCTTCATACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-283s1c1
Sequence:CCGGCAATGCTGTTTGGATTAACAACTCGAGTTGTTAATCCAAACAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012993.1-1737s1c1
Sequence:CCGGGCCTCCTGTTTAGTCCAACTTCTCGAGAAGTTGGACTAAACAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012993.1-609s1c1
Sequence:CCGGCCCAAACAAAGGCAGTGGAATCTCGAGATTCCACTGCCTTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-688s1c1
Sequence:CCGGCAAACCAGCTTACTATCCATTCTCGAGAATGGATAGTAAGCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012993.1-301s1c1
Sequence:CCGGCAAGGAGAGAAGAAGCTCACTCTCGAGAGTGAGCTTCTTCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks