EMAIL THIS PAGE TO A FRIEND

C9orf153

chromosome 9 open reading frame 153

79 Gene Product Result for
Synonyms: bA507D14.1
Species: Human C9orf153(389766)
UniProtKB ID: Q5TBE3, Q5TBE4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010907 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010907 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039401 predicted 238
2 SASI_Hs01_00039402 predicted 248
3 SASI_Hs01_00039403 predicted 144
4 SASI_Hs01_00039404 predicted 188
5 SASI_Hs01_00039405 predicted 218
6 SASI_Hs02_00305890 predicted 239
7 SASI_Hs01_00039406 predicted 234
8 SASI_Hs01_00039407 predicted 305
9 SASI_Hs01_00039408 predicted 229
10 SASI_Hs01_00039409 predicted 234
11 SASI_Hs01_00039410 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010907
C9orf153 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 153
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-187s1c1
Sequence:CCGGGAGAGCAAGAAATCAAATCTTCTCGAGAAGATTTGATTTCTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-148s1c1
Sequence:CCGGCTTCCAGAATTATATGCATGTCTCGAGACATGCATATAATTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-189s1c1
Sequence:CCGGGAGCAAGAAATCAAATCTTCTCTCGAGAGAAGATTTGATTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-179s21c1
Sequence:CCGGTTAATAAGGAGAGCAAGAAATCTCGAGATTTCTTGCTCTCCTTATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-214s21c1
Sequence:CCGGATGCATGGTATTTCACTTAACCTCGAGGTTAAGTGAAATACCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-233s21c1
Sequence:CCGGACGAAGCACAGGAAGTACTTGCTCGAGCAAGTACTTCCTGTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-141s21c1
Sequence:CCGGATGTTCACTTCCAGAATTATACTCGAGTATAATTCTGGAAGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010907
C9orf153 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 153
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-187s1c1
Sequence:CCGGGAGAGCAAGAAATCAAATCTTCTCGAGAAGATTTGATTTCTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-148s1c1
Sequence:CCGGCTTCCAGAATTATATGCATGTCTCGAGACATGCATATAATTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-189s1c1
Sequence:CCGGGAGCAAGAAATCAAATCTTCTCTCGAGAGAAGATTTGATTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-179s21c1
Sequence:CCGGTTAATAAGGAGAGCAAGAAATCTCGAGATTTCTTGCTCTCCTTATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-214s21c1
Sequence:CCGGATGCATGGTATTTCACTTAACCTCGAGGTTAAGTGAAATACCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-233s21c1
Sequence:CCGGACGAAGCACAGGAAGTACTTGCTCGAGCAAGTACTTCCTGTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-141s21c1
Sequence:CCGGATGTTCACTTCCAGAATTATACTCGAGTATAATTCTGGAAGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010907
C9orf153 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 153
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-187s1c1
Sequence:CCGGGAGAGCAAGAAATCAAATCTTCTCGAGAAGATTTGATTTCTTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-148s1c1
Sequence:CCGGCTTCCAGAATTATATGCATGTCTCGAGACATGCATATAATTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010907.1-189s1c1
Sequence:CCGGGAGCAAGAAATCAAATCTTCTCTCGAGAGAAGATTTGATTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-179s21c1
Sequence:CCGGTTAATAAGGAGAGCAAGAAATCTCGAGATTTCTTGCTCTCCTTATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-214s21c1
Sequence:CCGGATGCATGGTATTTCACTTAACCTCGAGGTTAAGTGAAATACCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-233s21c1
Sequence:CCGGACGAAGCACAGGAAGTACTTGCTCGAGCAAGTACTTCCTGTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010907.1-141s21c1
Sequence:CCGGATGTTCACTTCCAGAATTATACTCGAGTATAATTCTGGAAGTGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks