EMAIL THIS PAGE TO A FRIEND

C9orf156

chromosome 9 open reading frame 156

25 Gene Product Result for
Synonyms: HSPC219 NAP1
Species: Human C9orf156(51531)
UniProtKB ID: Q9BU70, Q5T113, Q86SK0, Q9NXJ7, Q9P0Q7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016481 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079791 MISSION® esiRNA esiRNA human C9orf156 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016481 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110829 predicted 1292
2 SASI_Hs02_00349537 predicted 289
3 SASI_Hs01_00110831 predicted 554
4 SASI_Hs01_00110832 predicted 610
5 SASI_Hs02_00349538 predicted 803
6 SASI_Hs01_00110834 predicted 1079
7 SASI_Hs01_00110835 predicted 709
8 SASI_Hs01_00110836 predicted 590
9 SASI_Hs01_00110837 predicted 618
10 SASI_Hs01_00110838 predicted 838
11 SASI_Hs01_00110830 predicted 254
12 SASI_Hs01_00110833 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016481
VALIDATED
C9orf156 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 156
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-479s21c1
Sequence:CCGGGGTAGAAGGTGGAGCTATATACTCGAGTATATAGCTCCACCTTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-259s21c1
Sequence:CCGGGGATTAGAAAGAGGATCTTTACTCGAGTAAAGATCCTCTTTCTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-1082s21c1
Sequence:CCGGCACTTTAGAAGTGCGGTTTACCTCGAGGTAAACCGCACTTCTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016481.2-1486s1c1
Sequence:CCGGCGAGAAGCAACACTTTGTGATCTCGAGATCACAAAGTGTTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-288s1c1
Sequence:CCGGGAACATTCCTTGATGGGCCTACTCGAGTAGGCCCATCAAGGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-533s1c1
Sequence:CCGGCGTACTAGACATCAAGCCCTACTCGAGTAGGGCTTGATGTCTAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016481.2-548s1c1
Sequence:CCGGGCCCTACATAGCTGAGTATGACTCGAGTCATACTCAGCTATGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-710s1c1
Sequence:CCGGCCACCATAGCACTAAGAGGAACTCGAGTTCCTCTTAGTGCTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-877s1c1
Sequence:CCGGCAGAAGAACAAATTGGCCCATCTCGAGATGGGCCAATTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016481.2-876s1c1
Sequence:CCGGGCAGAAGAACAAATTGGCCCACTCGAGTGGGCCAATTTGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016481.2-588s1c1
Sequence:CCGGGAGCCTTTAGCAGACTTTAATCTCGAGATTAAAGTCTGCTAAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016481
VALIDATED
C9orf156 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 156
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-479s21c1
Sequence:CCGGGGTAGAAGGTGGAGCTATATACTCGAGTATATAGCTCCACCTTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-259s21c1
Sequence:CCGGGGATTAGAAAGAGGATCTTTACTCGAGTAAAGATCCTCTTTCTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-1082s21c1
Sequence:CCGGCACTTTAGAAGTGCGGTTTACCTCGAGGTAAACCGCACTTCTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016481.2-1486s1c1
Sequence:CCGGCGAGAAGCAACACTTTGTGATCTCGAGATCACAAAGTGTTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-288s1c1
Sequence:CCGGGAACATTCCTTGATGGGCCTACTCGAGTAGGCCCATCAAGGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-533s1c1
Sequence:CCGGCGTACTAGACATCAAGCCCTACTCGAGTAGGGCTTGATGTCTAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016481.2-548s1c1
Sequence:CCGGGCCCTACATAGCTGAGTATGACTCGAGTCATACTCAGCTATGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-710s1c1
Sequence:CCGGCCACCATAGCACTAAGAGGAACTCGAGTTCCTCTTAGTGCTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-877s1c1
Sequence:CCGGCAGAAGAACAAATTGGCCCATCTCGAGATGGGCCAATTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016481.2-876s1c1
Sequence:CCGGGCAGAAGAACAAATTGGCCCACTCGAGTGGGCCAATTTGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016481.2-588s1c1
Sequence:CCGGGAGCCTTTAGCAGACTTTAATCTCGAGATTAAAGTCTGCTAAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016481
VALIDATED
C9orf156 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 156
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-479s21c1
Sequence:CCGGGGTAGAAGGTGGAGCTATATACTCGAGTATATAGCTCCACCTTCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-259s21c1
Sequence:CCGGGGATTAGAAAGAGGATCTTTACTCGAGTAAAGATCCTCTTTCTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016481.3-1082s21c1
Sequence:CCGGCACTTTAGAAGTGCGGTTTACCTCGAGGTAAACCGCACTTCTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016481.2-1486s1c1
Sequence:CCGGCGAGAAGCAACACTTTGTGATCTCGAGATCACAAAGTGTTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-288s1c1
Sequence:CCGGGAACATTCCTTGATGGGCCTACTCGAGTAGGCCCATCAAGGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-533s1c1
Sequence:CCGGCGTACTAGACATCAAGCCCTACTCGAGTAGGGCTTGATGTCTAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016481.2-548s1c1
Sequence:CCGGGCCCTACATAGCTGAGTATGACTCGAGTCATACTCAGCTATGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-710s1c1
Sequence:CCGGCCACCATAGCACTAAGAGGAACTCGAGTTCCTCTTAGTGCTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016481.2-877s1c1
Sequence:CCGGCAGAAGAACAAATTGGCCCATCTCGAGATGGGCCAATTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016481.2-876s1c1
Sequence:CCGGGCAGAAGAACAAATTGGCCCACTCGAGTGGGCCAATTTGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016481.2-588s1c1
Sequence:CCGGGAGCCTTTAGCAGACTTTAATCTCGAGATTAAAGTCTGCTAAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks