EMAIL THIS PAGE TO A FRIEND

C9orf163

chromosome 9 open reading frame 163

18 Gene Product Result for
Synonyms: RP11-413M3.11
Species: Human C9orf163(158055)
UniProtKB ID: Q8N9P6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152571 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027686 predicted 1514
2 SASI_Hs01_00027687 predicted 1236
3 SASI_Hs01_00027695 predicted 1394
4 SASI_Hs01_00027689 predicted 1592
5 SASI_Hs01_00027690 predicted 1552
6 SASI_Hs02_00366386 predicted 1267
7 SASI_Hs01_00027691 predicted 1276
8 SASI_Hs01_00027692 predicted 1525
9 SASI_Hs01_00027693 predicted 1389
10 SASI_Hs01_00027694 predicted 1383
11 SASI_Hs01_00027688 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152571
C9orf163 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 163
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1645s21c1
Sequence:CCGGGATGTTAGACAGCGGCTTCTGCTCGAGCAGAAGCCGCTGTCTAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1241s21c1
Sequence:CCGGCAATCTGCTCAGCTAACATTTCTCGAGAAATGTTAGCTGAGCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1936s21c1
Sequence:CCGGGAGCAAGATGAGCACCTAAACCTCGAGGTTTAGGTGCTCATCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1914s21c1
Sequence:CCGGTCAGGTCTTCATCTCTAAGATCTCGAGATCTTAGAGATGAAGACCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1560s21c1
Sequence:CCGGGCACTAAGCTATGGGAGAGACCTCGAGGTCTCTCCCATAGCTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1345s21c1
Sequence:CCGGATCTGCTTCTTCCCAGTGGTCCTCGAGGACCACTGGGAAGAAGCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-663s1c1
Sequence:CCGGGAGGTGTCATTGTTTGCCCTTCTCGAGAAGGGCAAACAATGACACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-752s1c1
Sequence:CCGGGTTCAAAGAACCCAAGAGCCACTCGAGTGGCTCTTGGGTTCTTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-657s1c1
Sequence:CCGGCGGAAGGAGGTGTCATTGTTTCTCGAGAAACAATGACACCTCCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-548s1c1
Sequence:CCGGGATTCCTGACCTGTTTGAACACTCGAGTGTTCAAACAGGTCAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152571
C9orf163 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 163
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1645s21c1
Sequence:CCGGGATGTTAGACAGCGGCTTCTGCTCGAGCAGAAGCCGCTGTCTAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1241s21c1
Sequence:CCGGCAATCTGCTCAGCTAACATTTCTCGAGAAATGTTAGCTGAGCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1936s21c1
Sequence:CCGGGAGCAAGATGAGCACCTAAACCTCGAGGTTTAGGTGCTCATCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1914s21c1
Sequence:CCGGTCAGGTCTTCATCTCTAAGATCTCGAGATCTTAGAGATGAAGACCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1560s21c1
Sequence:CCGGGCACTAAGCTATGGGAGAGACCTCGAGGTCTCTCCCATAGCTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1345s21c1
Sequence:CCGGATCTGCTTCTTCCCAGTGGTCCTCGAGGACCACTGGGAAGAAGCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-663s1c1
Sequence:CCGGGAGGTGTCATTGTTTGCCCTTCTCGAGAAGGGCAAACAATGACACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-752s1c1
Sequence:CCGGGTTCAAAGAACCCAAGAGCCACTCGAGTGGCTCTTGGGTTCTTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-657s1c1
Sequence:CCGGCGGAAGGAGGTGTCATTGTTTCTCGAGAAACAATGACACCTCCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-548s1c1
Sequence:CCGGGATTCCTGACCTGTTTGAACACTCGAGTGTTCAAACAGGTCAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152571
C9orf163 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 163
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1645s21c1
Sequence:CCGGGATGTTAGACAGCGGCTTCTGCTCGAGCAGAAGCCGCTGTCTAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1241s21c1
Sequence:CCGGCAATCTGCTCAGCTAACATTTCTCGAGAAATGTTAGCTGAGCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1936s21c1
Sequence:CCGGGAGCAAGATGAGCACCTAAACCTCGAGGTTTAGGTGCTCATCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152571.2-1914s21c1
Sequence:CCGGTCAGGTCTTCATCTCTAAGATCTCGAGATCTTAGAGATGAAGACCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1560s21c1
Sequence:CCGGGCACTAAGCTATGGGAGAGACCTCGAGGTCTCTCCCATAGCTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152571.2-1345s21c1
Sequence:CCGGATCTGCTTCTTCCCAGTGGTCCTCGAGGACCACTGGGAAGAAGCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-663s1c1
Sequence:CCGGGAGGTGTCATTGTTTGCCCTTCTCGAGAAGGGCAAACAATGACACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-752s1c1
Sequence:CCGGGTTCAAAGAACCCAAGAGCCACTCGAGTGGCTCTTGGGTTCTTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-657s1c1
Sequence:CCGGCGGAAGGAGGTGTCATTGTTTCTCGAGAAACAATGACACCTCCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152571.1-548s1c1
Sequence:CCGGGATTCCTGACCTGTTTGAACACTCGAGTGTTCAAACAGGTCAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)