EMAIL THIS PAGE TO A FRIEND

C9orf169

chromosome 9 open reading frame 169

35 Gene Product Result for
Species: Human C9orf169(375791)
UniProtKB ID: A8MQ03, Q86UY7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104230 Anti-C9orf169 (111-125) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199001 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135611 predicted 246
2 SASI_Hs02_00372515 predicted 628
3 SASI_Hs01_00135613 predicted 337
4 SASI_Hs01_00135614 predicted 685
5 SASI_Hs01_00135615 predicted 643
6 SASI_Hs02_00372516 predicted 238
7 SASI_Hs01_00135617 predicted 323
8 SASI_Hs01_00135618 predicted 694
9 SASI_Hs01_00135619 predicted 76
10 SASI_Hs02_00372517 predicted 97
11 SASI_Hs01_00135610 predicted 633
12 SASI_Hs01_00135612 predicted 538
13 SASI_Hs01_00135616 predicted 109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199001
C9orf169 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 169
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199001.1-464s1c1
Sequence:CCGGCTGCTGCTGTGTCATCTCCTACTCGAGTAGGAGATGACACAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199001.1-155s1c1
Sequence:CCGGCTGTTCCTCATCCTCGGAGATCTCGAGATCTCCGAGGATGAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-466s21c1
Sequence:CCGGGCTGCTGTGTCATCTCCTAGCCTCGAGGCTAGGAGATGACACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-385s21c1
Sequence:CCGGATGACATCGCCCACCACTGCTCTCGAGAGCAGTGGTGGGCGATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-206s21c1
Sequence:CCGGAGAGCCAACCCACCTCTTGCACTCGAGTGCAAGAGGTGGGTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199001.1-509s21c1
Sequence:CCGGGGACCCAGACTTCAGCAAATGCTCGAGCATTTGCTGAAGTCTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-145s21c1
Sequence:CCGGTGGCTTCCACCTGTTCCTCATCTCGAGATGAGGAACAGGTGGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-155s21c1
Sequence:CCGGCTGTTCCTCATCCTCGGAGATCTCGAGATCTCCGAGGATGAGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199001.1-519s21c1
Sequence:CCGGTTCAGCAAATGTGGCTCACACCTCGAGGTGTGAGCCACATTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-133s21c1
Sequence:CCGGAGCAGTTAGAGGTGGCTTCCACTCGAGTGGAAGCCACCTCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-83s21c1
Sequence:CCGGATATGCCCACATCAGCATCCCCTCGAGGGGATGCTGATGTGGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199001
C9orf169 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 169
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199001.1-464s1c1
Sequence:CCGGCTGCTGCTGTGTCATCTCCTACTCGAGTAGGAGATGACACAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199001.1-155s1c1
Sequence:CCGGCTGTTCCTCATCCTCGGAGATCTCGAGATCTCCGAGGATGAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-466s21c1
Sequence:CCGGGCTGCTGTGTCATCTCCTAGCCTCGAGGCTAGGAGATGACACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-385s21c1
Sequence:CCGGATGACATCGCCCACCACTGCTCTCGAGAGCAGTGGTGGGCGATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-206s21c1
Sequence:CCGGAGAGCCAACCCACCTCTTGCACTCGAGTGCAAGAGGTGGGTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199001.1-509s21c1
Sequence:CCGGGGACCCAGACTTCAGCAAATGCTCGAGCATTTGCTGAAGTCTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-145s21c1
Sequence:CCGGTGGCTTCCACCTGTTCCTCATCTCGAGATGAGGAACAGGTGGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-155s21c1
Sequence:CCGGCTGTTCCTCATCCTCGGAGATCTCGAGATCTCCGAGGATGAGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199001.1-519s21c1
Sequence:CCGGTTCAGCAAATGTGGCTCACACCTCGAGGTGTGAGCCACATTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-133s21c1
Sequence:CCGGAGCAGTTAGAGGTGGCTTCCACTCGAGTGGAAGCCACCTCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-83s21c1
Sequence:CCGGATATGCCCACATCAGCATCCCCTCGAGGGGATGCTGATGTGGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199001
C9orf169 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 169
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199001.1-464s1c1
Sequence:CCGGCTGCTGCTGTGTCATCTCCTACTCGAGTAGGAGATGACACAGCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199001.1-155s1c1
Sequence:CCGGCTGTTCCTCATCCTCGGAGATCTCGAGATCTCCGAGGATGAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-466s21c1
Sequence:CCGGGCTGCTGTGTCATCTCCTAGCCTCGAGGCTAGGAGATGACACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-385s21c1
Sequence:CCGGATGACATCGCCCACCACTGCTCTCGAGAGCAGTGGTGGGCGATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-206s21c1
Sequence:CCGGAGAGCCAACCCACCTCTTGCACTCGAGTGCAAGAGGTGGGTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199001.1-509s21c1
Sequence:CCGGGGACCCAGACTTCAGCAAATGCTCGAGCATTTGCTGAAGTCTGGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-145s21c1
Sequence:CCGGTGGCTTCCACCTGTTCCTCATCTCGAGATGAGGAACAGGTGGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-155s21c1
Sequence:CCGGCTGTTCCTCATCCTCGGAGATCTCGAGATCTCCGAGGATGAGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199001.1-519s21c1
Sequence:CCGGTTCAGCAAATGTGGCTCACACCTCGAGGTGTGAGCCACATTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-133s21c1
Sequence:CCGGAGCAGTTAGAGGTGGCTTCCACTCGAGTGGAAGCCACCTCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199001.1-83s21c1
Sequence:CCGGATATGCCCACATCAGCATCCCCTCGAGGGGATGCTGATGTGGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks