EMAIL THIS PAGE TO A FRIEND

C9orf16

chromosome 9 open reading frame 16

30 Gene Product Result for
Synonyms: EST00098
Species: Human C9orf16(79095)
UniProtKB ID: Q9BUW7, Q5SYV8, Q9Y3F7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024112 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048551 MISSION® esiRNA esiRNA human C9orf16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024112 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194003 predicted 468
2 SASI_Hs01_00194004 predicted 338
3 SASI_Hs01_00194009 predicted 219
4 SASI_Hs01_00194010 predicted 228
5 SASI_Hs01_00194005 predicted 446
6 SASI_Hs01_00194006 predicted 466
7 SASI_Hs02_00356605 predicted 222
8 SASI_Hs02_00356606 predicted 609
9 SASI_Hs01_00194007 predicted 628
10 SASI_Hs02_00356607 predicted 662
11 SASI_Hs01_00194008 predicted 529
12 SASI_Hs01_00194011 predicted 178
13 SASI_Hs01_00194012 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024112
VALIDATED
C9orf16 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-225s21c1
Sequence:CCGGCAGAATACGCTGCCATCAACTCTCGAGAGTTGATGGCAGCGTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-245s21c1
Sequence:CCGGTCCATGCTGGACCAGATCAACCTCGAGGTTGATCTGGTCCAGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-471s21c1
Sequence:CCGGCTGGCTTAGACACCTTCTCAACTCGAGTTGAGAAGGTGTCTAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-281s21c1
Sequence:CCGGCTGGAGGAGAAGAATGACCACCTCGAGGTGGTCATTCTTCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-259s21c1
Sequence:CCGGGATCAACTCCTGTCTGGACCACTCGAGTGGTCCAGACAGGAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024112
VALIDATED
C9orf16 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-225s21c1
Sequence:CCGGCAGAATACGCTGCCATCAACTCTCGAGAGTTGATGGCAGCGTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-245s21c1
Sequence:CCGGTCCATGCTGGACCAGATCAACCTCGAGGTTGATCTGGTCCAGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-471s21c1
Sequence:CCGGCTGGCTTAGACACCTTCTCAACTCGAGTTGAGAAGGTGTCTAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-281s21c1
Sequence:CCGGCTGGAGGAGAAGAATGACCACCTCGAGGTGGTCATTCTTCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-259s21c1
Sequence:CCGGGATCAACTCCTGTCTGGACCACTCGAGTGGTCCAGACAGGAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024112
VALIDATED
C9orf16 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-225s21c1
Sequence:CCGGCAGAATACGCTGCCATCAACTCTCGAGAGTTGATGGCAGCGTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-245s21c1
Sequence:CCGGTCCATGCTGGACCAGATCAACCTCGAGGTTGATCTGGTCCAGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-471s21c1
Sequence:CCGGCTGGCTTAGACACCTTCTCAACTCGAGTTGAGAAGGTGTCTAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-281s21c1
Sequence:CCGGCTGGAGGAGAAGAATGACCACCTCGAGGTGGTCATTCTTCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024112.3-259s21c1
Sequence:CCGGGATCAACTCCTGTCTGGACCACTCGAGTGGTCCAGACAGGAGTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks