EMAIL THIS PAGE TO A FRIEND

C9orf170

chromosome 9 open reading frame 170

54 Gene Product Result for
Species: Human C9orf170(401535)
UniProtKB ID: A2RU37
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001709 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180125 predicted 416
2 SASI_Hs01_00180126 predicted 437
3 SASI_Hs02_00303896 predicted 445
4 SASI_Hs01_00180127 predicted 1366
5 SASI_Hs01_00180128 predicted 1456
6 SASI_Hs02_00303897 predicted 1515
7 SASI_Hs01_00180130 predicted 1271
8 SASI_Hs01_00180131 predicted 2148
9 SASI_Hs01_00180133 predicted 1336
10 SASI_Hs01_00180134 predicted 1436
11 SASI_Hs01_00180129 predicted 2163
12 SASI_Hs01_00180132 predicted 1718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376885
C9orf170 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 170
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000121995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376885.1-471s1c1
Sequence:CCGGGATTGACAACTTCAGGAGAAACTCGAGTTTCTCCTGAAGTTGTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376885.1-2596s1c1
Sequence:CCGGGCAGATTGAAATAGCACTGTACTCGAGTACAGTGCTATTTCAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376885.1-1025s1c1
Sequence:CCGGGCCTTGATGAACTTTAATGAACTCGAGTTCATTAAAGTTCATCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376885
C9orf170 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 170
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000121995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376885.1-471s1c1
Sequence:CCGGGATTGACAACTTCAGGAGAAACTCGAGTTTCTCCTGAAGTTGTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376885.1-2596s1c1
Sequence:CCGGGCAGATTGAAATAGCACTGTACTCGAGTACAGTGCTATTTCAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376885.1-1025s1c1
Sequence:CCGGGCCTTGATGAACTTTAATGAACTCGAGTTCATTAAAGTTCATCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376885
C9orf170 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 170
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000121995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376885.1-471s1c1
Sequence:CCGGGATTGACAACTTCAGGAGAAACTCGAGTTTCTCCTGAAGTTGTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376885.1-2596s1c1
Sequence:CCGGGCAGATTGAAATAGCACTGTACTCGAGTACAGTGCTATTTCAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376885.1-1025s1c1
Sequence:CCGGGCCTTGATGAACTTTAATGAACTCGAGTTCATTAAAGTTCATCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001709
C9orf170 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 170
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001709.1-1289s1c1
Sequence:CCGGCGGATATGAGAAAGGGCATAACTCGAGTTATGCCCTTTCTCATATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-363s1c1
Sequence:CCGGCTTGATAGATGTCACTCGGGACTCGAGTCCCGAGTGACATCTATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-324s1c1
Sequence:CCGGGTCTGATTTAGGAGTCGGAAGCTCGAGCTTCCGACTCCTAAATCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-366s1c1
Sequence:CCGGGATAGATGTCACTCGGGAAGACTCGAGTCTTCCCGAGTGACATCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001709.1-253s1c1
Sequence:CCGGGACGTTCTGTTTCTCCGGAAACTCGAGTTTCCGGAGAAACAGAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-309s1c1
Sequence:CCGGCAACTTCAGGAGAAAGTCTGACTCGAGTCAGACTTTCTCCTGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-307s1c1
Sequence:CCGGGACAACTTCAGGAGAAAGTCTCTCGAGAGACTTTCTCCTGAAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001709.1-427s1c1
Sequence:CCGGGTGAACTGTGAAACAGACCAACTCGAGTTGGTCTGTTTCACAGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001709
C9orf170 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 170
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001709.1-1289s1c1
Sequence:CCGGCGGATATGAGAAAGGGCATAACTCGAGTTATGCCCTTTCTCATATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-363s1c1
Sequence:CCGGCTTGATAGATGTCACTCGGGACTCGAGTCCCGAGTGACATCTATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-324s1c1
Sequence:CCGGGTCTGATTTAGGAGTCGGAAGCTCGAGCTTCCGACTCCTAAATCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-366s1c1
Sequence:CCGGGATAGATGTCACTCGGGAAGACTCGAGTCTTCCCGAGTGACATCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001709.1-253s1c1
Sequence:CCGGGACGTTCTGTTTCTCCGGAAACTCGAGTTTCCGGAGAAACAGAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-309s1c1
Sequence:CCGGCAACTTCAGGAGAAAGTCTGACTCGAGTCAGACTTTCTCCTGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-307s1c1
Sequence:CCGGGACAACTTCAGGAGAAAGTCTCTCGAGAGACTTTCTCCTGAAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001709.1-427s1c1
Sequence:CCGGGTGAACTGTGAAACAGACCAACTCGAGTTGGTCTGTTTCACAGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001709
C9orf170 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 170
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001709.1-1289s1c1
Sequence:CCGGCGGATATGAGAAAGGGCATAACTCGAGTTATGCCCTTTCTCATATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-363s1c1
Sequence:CCGGCTTGATAGATGTCACTCGGGACTCGAGTCCCGAGTGACATCTATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-324s1c1
Sequence:CCGGGTCTGATTTAGGAGTCGGAAGCTCGAGCTTCCGACTCCTAAATCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-366s1c1
Sequence:CCGGGATAGATGTCACTCGGGAAGACTCGAGTCTTCCCGAGTGACATCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001709.1-253s1c1
Sequence:CCGGGACGTTCTGTTTCTCCGGAAACTCGAGTTTCCGGAGAAACAGAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-309s1c1
Sequence:CCGGCAACTTCAGGAGAAAGTCTGACTCGAGTCAGACTTTCTCCTGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001709.1-307s1c1
Sequence:CCGGGACAACTTCAGGAGAAAGTCTCTCGAGAGACTTTCTCCTGAAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001709.1-427s1c1
Sequence:CCGGGTGAACTGTGAAACAGACCAACTCGAGTTGGTCTGTTTCACAGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)