EMAIL THIS PAGE TO A FRIEND

C9orf171

chromosome 9 open reading frame 171

45 Gene Product Result for
Species: Human C9orf171(389799)
UniProtKB ID: Q6ZQR2, Q147X1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207417 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114142 predicted 841
2 SASI_Hs01_00114144 predicted 1483
3 SASI_Hs01_00114145 predicted 495
4 SASI_Hs01_00114146 predicted 382
5 SASI_Hs02_00374049 predicted 373
6 SASI_Hs01_00114148 predicted 423
7 SASI_Hs01_00114149 predicted 554
8 SASI_Hs01_00114150 predicted 531
9 SASI_Hs02_00374050 predicted 601
10 SASI_Hs02_00374051 predicted 404
11 SASI_Hs01_00114143 predicted 466
12 SASI_Hs01_00114147 predicted 678
13 SASI_Hs01_00114151 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207417
C9orf171 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 171
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-504s1c1
Sequence:CCGGGACCCGGAATTATATCGCAATCTCGAGATTGCGATATAATTCCGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-300s1c1
Sequence:CCGGGCAGAAAGTTATTCCTTCCCTCTCGAGAGGGAAGGAATAACTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-756s1c1
Sequence:CCGGGAAAGCCATCAAACTGGAGAACTCGAGTTCTCCAGTTTGATGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-507s1c1
Sequence:CCGGCCGGAATTATATCGCAATGAACTCGAGTTCATTGCGATATAATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-765s1c1
Sequence:CCGGCAAACTGGAGAAGAAGCAGAACTCGAGTTCTGCTTCTTCTCCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-506s1c1
Sequence:CCGGCCCGGAATTATATCGCAATGACTCGAGTCATTGCGATATAATTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207417.1-1036s1c1
Sequence:CCGGGCCATCTTGACATAGTGGAAACTCGAGTTTCCACTATGTCAAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207417.1-1421s1c1
Sequence:CCGGCGTGCTTTGAAAGACCTCATTCTCGAGAATGAGGTCTTTCAAAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207417
C9orf171 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 171
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-504s1c1
Sequence:CCGGGACCCGGAATTATATCGCAATCTCGAGATTGCGATATAATTCCGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-300s1c1
Sequence:CCGGGCAGAAAGTTATTCCTTCCCTCTCGAGAGGGAAGGAATAACTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-756s1c1
Sequence:CCGGGAAAGCCATCAAACTGGAGAACTCGAGTTCTCCAGTTTGATGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-507s1c1
Sequence:CCGGCCGGAATTATATCGCAATGAACTCGAGTTCATTGCGATATAATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-765s1c1
Sequence:CCGGCAAACTGGAGAAGAAGCAGAACTCGAGTTCTGCTTCTTCTCCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-506s1c1
Sequence:CCGGCCCGGAATTATATCGCAATGACTCGAGTCATTGCGATATAATTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207417.1-1036s1c1
Sequence:CCGGGCCATCTTGACATAGTGGAAACTCGAGTTTCCACTATGTCAAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207417.1-1421s1c1
Sequence:CCGGCGTGCTTTGAAAGACCTCATTCTCGAGAATGAGGTCTTTCAAAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207417
C9orf171 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 171
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-504s1c1
Sequence:CCGGGACCCGGAATTATATCGCAATCTCGAGATTGCGATATAATTCCGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-300s1c1
Sequence:CCGGGCAGAAAGTTATTCCTTCCCTCTCGAGAGGGAAGGAATAACTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-756s1c1
Sequence:CCGGGAAAGCCATCAAACTGGAGAACTCGAGTTCTCCAGTTTGATGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207417.1-507s1c1
Sequence:CCGGCCGGAATTATATCGCAATGAACTCGAGTTCATTGCGATATAATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-765s1c1
Sequence:CCGGCAAACTGGAGAAGAAGCAGAACTCGAGTTCTGCTTCTTCTCCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207417.1-506s1c1
Sequence:CCGGCCCGGAATTATATCGCAATGACTCGAGTCATTGCGATATAATTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207417.1-1036s1c1
Sequence:CCGGGCCATCTTGACATAGTGGAAACTCGAGTTTCCACTATGTCAAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207417.1-1421s1c1
Sequence:CCGGCGTGCTTTGAAAGACCTCATTCTCGAGAATGAGGTCTTTCAAAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)