EMAIL THIS PAGE TO A FRIEND

C9orf172

chromosome 9 open reading frame 172

25 Gene Product Result for
Species: Human C9orf172(389813)
UniProtKB ID: C9J069
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021200 Anti-C9orf172 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080482 Rosetta Predictions human pricing
XM_372159 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315266 predicted 1585
2 SASI_Hs02_00315267 predicted 1048
3 SASI_Hs02_00315268 predicted 832
4 SASI_Hs02_00315269 predicted 1217
5 SASI_Hs02_00315270 predicted 830
6 SASI_Hs02_00315271 predicted 1153
7 SASI_Hs02_00315272 predicted 2324
8 SASI_Hs02_00315273 predicted 1474
9 SASI_Hs02_00315274 predicted 1521
10 SASI_Hs02_00315275 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271636 predicted 1498
2 SASI_Hs01_00271637 predicted 945
3 SASI_Hs01_00271638 predicted 1125
4 SASI_Hs01_00271639 predicted 1036
5 SASI_Hs01_00271640 predicted 1057
6 SASI_Hs01_00271641 predicted 1380
7 SASI_Hs01_00271642 predicted 1432
8 SASI_Hs01_00271643 predicted 2809
9 SASI_Hs01_00271644 predicted 2631
10 SASI_Hs01_00271645 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080482
C9orf172 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 172
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2058s21c1
Sequence:CCGGCCACAGCTGCTACACCTACTACTCGAGTAGTAGGTGTAGCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-429s21c1
Sequence:CCGGCAACGAGCTGCATCCCATCAACTCGAGTTGATGGGATGCAGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-1595s21c1
Sequence:CCGGAGATCACCATCACTGACAATGCTCGAGCATTGTCAGTGATGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2030s21c1
Sequence:CCGGTCAACGCCTGCCTCTACTTCACTCGAGTGAAGTAGAGGCAGGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2760s21c1
Sequence:CCGGCTACGAGCAGCTTTGCGAGTTCTCGAGAACTCGCAAAGCTGCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080482
C9orf172 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 172
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2058s21c1
Sequence:CCGGCCACAGCTGCTACACCTACTACTCGAGTAGTAGGTGTAGCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-429s21c1
Sequence:CCGGCAACGAGCTGCATCCCATCAACTCGAGTTGATGGGATGCAGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-1595s21c1
Sequence:CCGGAGATCACCATCACTGACAATGCTCGAGCATTGTCAGTGATGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2030s21c1
Sequence:CCGGTCAACGCCTGCCTCTACTTCACTCGAGTGAAGTAGAGGCAGGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2760s21c1
Sequence:CCGGCTACGAGCAGCTTTGCGAGTTCTCGAGAACTCGCAAAGCTGCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080482
C9orf172 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 172
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2058s21c1
Sequence:CCGGCCACAGCTGCTACACCTACTACTCGAGTAGTAGGTGTAGCAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-429s21c1
Sequence:CCGGCAACGAGCTGCATCCCATCAACTCGAGTTGATGGGATGCAGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-1595s21c1
Sequence:CCGGAGATCACCATCACTGACAATGCTCGAGCATTGTCAGTGATGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2030s21c1
Sequence:CCGGTCAACGCCTGCCTCTACTTCACTCGAGTGAAGTAGAGGCAGGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080482.2-2760s21c1
Sequence:CCGGCTACGAGCAGCTTTGCGAGTTCTCGAGAACTCGCAAAGCTGCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks