EMAIL THIS PAGE TO A FRIEND

C9orf173

chromosome 9 open reading frame 173

18 Gene Product Result for
Species: Human C9orf173(441476)
UniProtKB ID: Q8N7X2, A2RU24, B7ZM72, B7ZM76, Q8NEA3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004353 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004353 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082411 predicted 775
2 SASI_Hs01_00082406 predicted 193
3 SASI_Hs01_00082407 predicted 433
4 SASI_Hs01_00082408 predicted 825
5 SASI_Hs01_00082409 predicted 472
6 SASI_Hs01_00082410 predicted 199
7 SASI_Hs01_00082412 predicted 430
8 SASI_Hs01_00082413 predicted 480
9 SASI_Hs02_00304573 predicted 288
10 SASI_Hs01_00082415 predicted 871
11 SASI_Hs01_00082414 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004353
C9orf173 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 173
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-704s21c1
Sequence:CCGGCCAACACCTACAATATCCTTCCTCGAGGAAGGATATTGTAGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-259s21c1
Sequence:CCGGCAGACCCTGAGGGAACTATTGCTCGAGCAATAGTTCCCTCAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-203s21c1
Sequence:CCGGCAGTTGGCCTCAGGTTACAGACTCGAGTCTGTAACCTGAGGCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-473s21c1
Sequence:CCGGAGAAAGCTGACTTCGACCAAGCTCGAGCTTGGTCGAAGTCAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-574s21c1
Sequence:CCGGTCCGCTTCCAAGACACCTGAACTCGAGTTCAGGTGTCTTGGAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004353
C9orf173 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 173
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-704s21c1
Sequence:CCGGCCAACACCTACAATATCCTTCCTCGAGGAAGGATATTGTAGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-259s21c1
Sequence:CCGGCAGACCCTGAGGGAACTATTGCTCGAGCAATAGTTCCCTCAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-203s21c1
Sequence:CCGGCAGTTGGCCTCAGGTTACAGACTCGAGTCTGTAACCTGAGGCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-473s21c1
Sequence:CCGGAGAAAGCTGACTTCGACCAAGCTCGAGCTTGGTCGAAGTCAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-574s21c1
Sequence:CCGGTCCGCTTCCAAGACACCTGAACTCGAGTTCAGGTGTCTTGGAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004353
C9orf173 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 173
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-704s21c1
Sequence:CCGGCCAACACCTACAATATCCTTCCTCGAGGAAGGATATTGTAGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-259s21c1
Sequence:CCGGCAGACCCTGAGGGAACTATTGCTCGAGCAATAGTTCCCTCAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-203s21c1
Sequence:CCGGCAGTTGGCCTCAGGTTACAGACTCGAGTCTGTAACCTGAGGCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-473s21c1
Sequence:CCGGAGAAAGCTGACTTCGACCAAGCTCGAGCTTGGTCGAAGTCAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004353.2-574s21c1
Sequence:CCGGTCCGCTTCCAAGACACCTGAACTCGAGTTCAGGTGTCTTGGAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks