EMAIL THIS PAGE TO A FRIEND

C9orf24

chromosome 9 open reading frame 24

Synonyms: CBE1 NYD-SP22 SMRP1 bA573M23.4
Gene ID:
Human(84688) Summary: This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
chicken(427402) chromosome Z open reading frame, human C9orf24
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032596 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152041 MISSION® esiRNA esiRNA human C9orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032596 Rosetta Predictions human pricing
NM_147168 Rosetta Predictions human pricing
NM_147169 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047360 predicted 943
2 SASI_Hs01_00047361 predicted 830
3 SASI_Hs01_00047362 predicted 938
4 SASI_Hs01_00047363 predicted 899
5 SASI_Hs01_00047364 predicted 907
6 SASI_Hs01_00047365 predicted 934
7 SASI_Hs01_00047366 predicted 838
8 SASI_Hs01_00047367 predicted 816
9 SASI_Hs01_00047368 predicted 919
10 SASI_Hs01_00047369 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127356 predicted 485
2 SASI_Hs01_00127357 predicted 336
3 SASI_Hs01_00127358 predicted 375
4 SASI_Hs01_00127359 predicted 326
5 SASI_Hs01_00127360 predicted 205
6 SASI_Hs01_00127361 predicted 439
7 SASI_Hs01_00127362 predicted 449
8 SASI_Hs01_00127363 predicted 380
9 SASI_Hs01_00127364 predicted 225
10 SASI_Hs02_00365503 predicted 199
11 SASI_Hs01_00127355 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176790 predicted 325
2 SASI_Hs01_00176791 predicted 207
3 SASI_Hs01_00176792 predicted 331
4 SASI_Hs01_00176793 predicted 319
5 SASI_Hs01_00176794 predicted 232
6 SASI_Hs01_00176795 predicted 193
7 SASI_Hs01_00176796 predicted 321
8 SASI_Hs01_00176797 predicted 305
9 SASI_Hs02_00365504 predicted 324
10 SASI_Hs01_00176798 predicted 218
11 SASI_Hs01_00176799 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032596
C9orf24 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 24
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032596.3-794s21c1
Sequence:CCGGGCCCTTCCATGGTTACGAAAGCTCGAGCTTTCGTAACCATGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032596.3-362s21c1
Sequence:CCGGTCATACCATGGAGCGACATGTCTCGAGACATGTCGCTCCATGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-417s1c1
Sequence:CCGGGCTGTACAGGACTACACTTATCTCGAGATAAGTGTAGTCCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-533s1c1
Sequence:CCGGCTGGTACAACACATGGAGGATCTCGAGATCCTCCATGTGTTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-248s1c1
Sequence:CCGGCCCTATCAGTACCTACAGTGACTCGAGTCACTGTAGGTACTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-409s1c1
Sequence:CCGGCCAAATGTGCTGTACAGGACTCTCGAGAGTCCTGTACAGCACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032596.3-526s1c1
Sequence:CCGGGCAGTGACTGGTACAACACATCTCGAGATGTGTTGTACCAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-254s1c1
Sequence:CCGGCAGTACCTACAGTGACTCCTACTCGAGTAGGAGTCACTGTAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032596
C9orf24 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 24
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032596.3-794s21c1
Sequence:CCGGGCCCTTCCATGGTTACGAAAGCTCGAGCTTTCGTAACCATGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032596.3-362s21c1
Sequence:CCGGTCATACCATGGAGCGACATGTCTCGAGACATGTCGCTCCATGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-417s1c1
Sequence:CCGGGCTGTACAGGACTACACTTATCTCGAGATAAGTGTAGTCCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-533s1c1
Sequence:CCGGCTGGTACAACACATGGAGGATCTCGAGATCCTCCATGTGTTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-248s1c1
Sequence:CCGGCCCTATCAGTACCTACAGTGACTCGAGTCACTGTAGGTACTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-409s1c1
Sequence:CCGGCCAAATGTGCTGTACAGGACTCTCGAGAGTCCTGTACAGCACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032596.3-526s1c1
Sequence:CCGGGCAGTGACTGGTACAACACATCTCGAGATGTGTTGTACCAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-254s1c1
Sequence:CCGGCAGTACCTACAGTGACTCCTACTCGAGTAGGAGTCACTGTAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032596
C9orf24 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 24
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032596.3-794s21c1
Sequence:CCGGGCCCTTCCATGGTTACGAAAGCTCGAGCTTTCGTAACCATGGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032596.3-362s21c1
Sequence:CCGGTCATACCATGGAGCGACATGTCTCGAGACATGTCGCTCCATGGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-417s1c1
Sequence:CCGGGCTGTACAGGACTACACTTATCTCGAGATAAGTGTAGTCCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-533s1c1
Sequence:CCGGCTGGTACAACACATGGAGGATCTCGAGATCCTCCATGTGTTGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-248s1c1
Sequence:CCGGCCCTATCAGTACCTACAGTGACTCGAGTCACTGTAGGTACTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-409s1c1
Sequence:CCGGCCAAATGTGCTGTACAGGACTCTCGAGAGTCCTGTACAGCACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142433    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032596.3-526s1c1
Sequence:CCGGGCAGTGACTGGTACAACACATCTCGAGATGTGTTGTACCAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032596.3-254s1c1
Sequence:CCGGCAGTACCTACAGTGACTCCTACTCGAGTAGGAGTCACTGTAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks