EMAIL THIS PAGE TO A FRIEND

C9orf37

chromosome 9 open reading frame 37

16 Gene Product Result for
Species: Human C9orf37(85026)
UniProtKB ID: Q9H2J1, Q17RM5, Q5T368
Gene ID:
Human(85026) Summary: While this gene appears to be transcribed and translated to make a protein, no function has been assigned to the protein. [provided by RefSeq, Apr 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032937 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203594 predicted 1061
2 SASI_Hs01_00203595 predicted 992
3 SASI_Hs01_00203596 predicted 989
4 SASI_Hs01_00203597 predicted 956
5 SASI_Hs01_00203598 predicted 948
6 SASI_Hs01_00203599 predicted 1136
7 SASI_Hs01_00203600 predicted 1065
8 SASI_Hs01_00203601 predicted 1123
9 SASI_Hs02_00360554 predicted 855
10 SASI_Hs02_00360555 predicted 889
11 SASI_Hs01_00203602 predicted 1030
12 SASI_Hs01_00203603 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032937
C9orf37 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 37
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032937.3-1063s21c1
Sequence:CCGGCAGGAGCCAAGGCACAAATTTCTCGAGAAATTTGTGCCTTGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-657s21c1
Sequence:CCGGAGATAAGGTAACTGACAAACCCTCGAGGGTTTGTCAGTTACCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-737s21c1
Sequence:CCGGCACCACCATCTCCGTTGTTTCCTCGAGGAAACAACGGAGATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-846s21c1
Sequence:CCGGTTCCACAGAACCCTGCCTTTCCTCGAGGAAAGGCAGGGTTCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-1037s21c1
Sequence:CCGGTTGGGAACCTGGGTGCCTAAACTCGAGTTTAGGCACCCAGGTTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032937.2-575s1c1
Sequence:CCGGGAACTCCTGACCTCAAGCAATCTCGAGATTGCTTGAGGTCAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032937.2-758s1c1
Sequence:CCGGCCATCTCCGTTGTTTCTGGAACTCGAGTTCCAGAAACAACGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032937.3-1070s1c1
Sequence:CCGGCAAGGCACAAATTTAACCAAACTCGAGTTTGGTTAAATTTGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032937
C9orf37 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 37
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032937.3-1063s21c1
Sequence:CCGGCAGGAGCCAAGGCACAAATTTCTCGAGAAATTTGTGCCTTGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-657s21c1
Sequence:CCGGAGATAAGGTAACTGACAAACCCTCGAGGGTTTGTCAGTTACCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-737s21c1
Sequence:CCGGCACCACCATCTCCGTTGTTTCCTCGAGGAAACAACGGAGATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-846s21c1
Sequence:CCGGTTCCACAGAACCCTGCCTTTCCTCGAGGAAAGGCAGGGTTCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-1037s21c1
Sequence:CCGGTTGGGAACCTGGGTGCCTAAACTCGAGTTTAGGCACCCAGGTTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032937.2-575s1c1
Sequence:CCGGGAACTCCTGACCTCAAGCAATCTCGAGATTGCTTGAGGTCAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032937.2-758s1c1
Sequence:CCGGCCATCTCCGTTGTTTCTGGAACTCGAGTTCCAGAAACAACGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032937.3-1070s1c1
Sequence:CCGGCAAGGCACAAATTTAACCAAACTCGAGTTTGGTTAAATTTGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032937
C9orf37 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 37
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032937.3-1063s21c1
Sequence:CCGGCAGGAGCCAAGGCACAAATTTCTCGAGAAATTTGTGCCTTGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-657s21c1
Sequence:CCGGAGATAAGGTAACTGACAAACCCTCGAGGGTTTGTCAGTTACCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-737s21c1
Sequence:CCGGCACCACCATCTCCGTTGTTTCCTCGAGGAAACAACGGAGATGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-846s21c1
Sequence:CCGGTTCCACAGAACCCTGCCTTTCCTCGAGGAAAGGCAGGGTTCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032937.3-1037s21c1
Sequence:CCGGTTGGGAACCTGGGTGCCTAAACTCGAGTTTAGGCACCCAGGTTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032937.2-575s1c1
Sequence:CCGGGAACTCCTGACCTCAAGCAATCTCGAGATTGCTTGAGGTCAGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032937.2-758s1c1
Sequence:CCGGCCATCTCCGTTGTTTCTGGAACTCGAGTTCCAGAAACAACGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032937.3-1070s1c1
Sequence:CCGGCAAGGCACAAATTTAACCAAACTCGAGTTTGGTTAAATTTGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks