EMAIL THIS PAGE TO A FRIEND

C9orf3

chromosome 9 open reading frame 3

77 Gene Product Result for
Synonyms: AOPEP AP-O APO C90RF3 ONPEP
Species: Human C9orf3(84909)
Gene ID:
Human(84909) Summary: This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032823 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141041 MISSION® esiRNA esiRNA human C9orf3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032823 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055930 predicted 2416
2 SASI_Hs01_00055931 predicted 470
3 SASI_Hs01_00055932 predicted 1639
4 SASI_Hs01_00055933 predicted 2406
5 SASI_Hs01_00055934 predicted 2348
6 SASI_Hs01_00055935 predicted 898
7 SASI_Hs01_00055936 predicted 749
8 SASI_Hs01_00055937 predicted 525
9 SASI_Hs01_00055938 predicted 200
10 SASI_Hs01_00055939 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032823
VALIDATED
C9orf3 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032823.3-2349s1c1
Sequence:CCGGCCACAGCAAGATTCTTTCATTCTCGAGAATGAAAGAATCTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-2143s1c1
Sequence:CCGGGCACAAGTTCACGAAAGCCTACTCGAGTAGGCTTTCGTGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-616s1c1
Sequence:CCGGCTGCTGTGATTTATCTGTGTTCTCGAGAACACAGATAAATCACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-1149s1c1
Sequence:CCGGGCTGGTATTACTATGTAACTACTCGAGTAGTTACATAGTAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-618s1c1
Sequence:CCGGGCTGTGATTTATCTGTGTTAACTCGAGTTAACACAGATAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-772s21c1
Sequence:CCGGGAGGGAGCAGTTAGACTATTACTCGAGTAATAGTCTAACTGCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-1365s21c1
Sequence:CCGGTCATTCCTCATCGGGTCTTTGCTCGAGCAAAGACCCGATGAGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032823.3-2412s21c1
Sequence:CCGGGACATCAAAGGAGGGATTATGCTCGAGCATAATCCCTCCTTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-445s21c1
Sequence:CCGGCTCATCTGAAATGGAATATAACTCGAGTTATATTCCATTTCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032823
VALIDATED
C9orf3 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032823.3-2349s1c1
Sequence:CCGGCCACAGCAAGATTCTTTCATTCTCGAGAATGAAAGAATCTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-2143s1c1
Sequence:CCGGGCACAAGTTCACGAAAGCCTACTCGAGTAGGCTTTCGTGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-616s1c1
Sequence:CCGGCTGCTGTGATTTATCTGTGTTCTCGAGAACACAGATAAATCACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-1149s1c1
Sequence:CCGGGCTGGTATTACTATGTAACTACTCGAGTAGTTACATAGTAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-618s1c1
Sequence:CCGGGCTGTGATTTATCTGTGTTAACTCGAGTTAACACAGATAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-772s21c1
Sequence:CCGGGAGGGAGCAGTTAGACTATTACTCGAGTAATAGTCTAACTGCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-1365s21c1
Sequence:CCGGTCATTCCTCATCGGGTCTTTGCTCGAGCAAAGACCCGATGAGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032823.3-2412s21c1
Sequence:CCGGGACATCAAAGGAGGGATTATGCTCGAGCATAATCCCTCCTTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-445s21c1
Sequence:CCGGCTCATCTGAAATGGAATATAACTCGAGTTATATTCCATTTCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032823
VALIDATED
C9orf3 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032823.3-2349s1c1
Sequence:CCGGCCACAGCAAGATTCTTTCATTCTCGAGAATGAAAGAATCTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-2143s1c1
Sequence:CCGGGCACAAGTTCACGAAAGCCTACTCGAGTAGGCTTTCGTGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-616s1c1
Sequence:CCGGCTGCTGTGATTTATCTGTGTTCTCGAGAACACAGATAAATCACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-1149s1c1
Sequence:CCGGGCTGGTATTACTATGTAACTACTCGAGTAGTTACATAGTAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032823.3-618s1c1
Sequence:CCGGGCTGTGATTTATCTGTGTTAACTCGAGTTAACACAGATAAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-772s21c1
Sequence:CCGGGAGGGAGCAGTTAGACTATTACTCGAGTAATAGTCTAACTGCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-1365s21c1
Sequence:CCGGTCATTCCTCATCGGGTCTTTGCTCGAGCAAAGACCCGATGAGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032823.3-2412s21c1
Sequence:CCGGGACATCAAAGGAGGGATTATGCTCGAGCATAATCCCTCCTTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032823.3-445s21c1
Sequence:CCGGCTCATCTGAAATGGAATATAACTCGAGTTATATTCCATTTCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks