EMAIL THIS PAGE TO A FRIEND

C9orf40

chromosome 9 open reading frame 40

106 Gene Product Result for
Species: Human C9orf40(55071)
UniProtKB ID: Q8IXQ3, Q9NWD3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017998 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017998 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047145 predicted 881
2 SASI_Hs01_00047146 predicted 1305
3 SASI_Hs01_00047147 predicted 909
4 SASI_Hs01_00047148 predicted 1019
5 SASI_Hs01_00047150 predicted 897
6 SASI_Hs01_00047151 predicted 1075
7 SASI_Hs02_00351060 predicted 1314
8 SASI_Hs01_00047153 predicted 892
9 SASI_Hs02_00351061 predicted 1259
10 SASI_Hs02_00351062 predicted 1276
11 SASI_Hs01_00047149 predicted 1293
12 SASI_Hs01_00047152 predicted 994
13 SASI_Hs01_00047154 predicted 1118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017998
VALIDATED
C9orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-971s1c1
Sequence:CCGGCCTGAGAAATGAAGAAAGATTCTCGAGAATCTTTCTTCATTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-1600s1c1
Sequence:CCGGCCTTATTACTTTAGACCTGTACTCGAGTACAGGTCTAAAGTAATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017998.1-768s1c1
Sequence:CCGGCTGGCAGACATTGAAGATTTACTCGAGTAAATCTTCAATGTCTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017998.1-1417s1c1
Sequence:CCGGCGTGTTTGCAAAGCTTCCAATCTCGAGATTGGAAGCTTTGCAAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-694s1c1
Sequence:CCGGCGTGCCAGCACAATGAAGAATCTCGAGATTCTTCATTGTGCTGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-800s1c1
Sequence:CCGGCCTGACAGAAGCAACACTTCACTCGAGTGAAGTGTTGCTTCTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017998.1-1416s1c1
Sequence:CCGGGCGTGTTTGCAAAGCTTCCAACTCGAGTTGGAAGCTTTGCAAACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-1778s1c1
Sequence:CCGGCCAGTAGACTAATGGTCGTTTCTCGAGAAACGACCATTAGTCTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-743s1c1
Sequence:CCGGGAGGAATCCTTTGCCTCCTATCTCGAGATAGGAGGCAAAGGATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017998.1-966s1c1
Sequence:CCGGCCAAACCTGAGAAATGAAGAACTCGAGTTCTTCATTTCTCAGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017998
VALIDATED
C9orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-971s1c1
Sequence:CCGGCCTGAGAAATGAAGAAAGATTCTCGAGAATCTTTCTTCATTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-1600s1c1
Sequence:CCGGCCTTATTACTTTAGACCTGTACTCGAGTACAGGTCTAAAGTAATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017998.1-768s1c1
Sequence:CCGGCTGGCAGACATTGAAGATTTACTCGAGTAAATCTTCAATGTCTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017998.1-1417s1c1
Sequence:CCGGCGTGTTTGCAAAGCTTCCAATCTCGAGATTGGAAGCTTTGCAAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-694s1c1
Sequence:CCGGCGTGCCAGCACAATGAAGAATCTCGAGATTCTTCATTGTGCTGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-800s1c1
Sequence:CCGGCCTGACAGAAGCAACACTTCACTCGAGTGAAGTGTTGCTTCTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017998.1-1416s1c1
Sequence:CCGGGCGTGTTTGCAAAGCTTCCAACTCGAGTTGGAAGCTTTGCAAACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-1778s1c1
Sequence:CCGGCCAGTAGACTAATGGTCGTTTCTCGAGAAACGACCATTAGTCTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-743s1c1
Sequence:CCGGGAGGAATCCTTTGCCTCCTATCTCGAGATAGGAGGCAAAGGATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017998.1-966s1c1
Sequence:CCGGCCAAACCTGAGAAATGAAGAACTCGAGTTCTTCATTTCTCAGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017998
VALIDATED
C9orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-971s1c1
Sequence:CCGGCCTGAGAAATGAAGAAAGATTCTCGAGAATCTTTCTTCATTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-1600s1c1
Sequence:CCGGCCTTATTACTTTAGACCTGTACTCGAGTACAGGTCTAAAGTAATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017998.1-768s1c1
Sequence:CCGGCTGGCAGACATTGAAGATTTACTCGAGTAAATCTTCAATGTCTGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017998.1-1417s1c1
Sequence:CCGGCGTGTTTGCAAAGCTTCCAATCTCGAGATTGGAAGCTTTGCAAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-694s1c1
Sequence:CCGGCGTGCCAGCACAATGAAGAATCTCGAGATTCTTCATTGTGCTGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-800s1c1
Sequence:CCGGCCTGACAGAAGCAACACTTCACTCGAGTGAAGTGTTGCTTCTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017998.1-1416s1c1
Sequence:CCGGGCGTGTTTGCAAAGCTTCCAACTCGAGTTGGAAGCTTTGCAAACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017998.1-1778s1c1
Sequence:CCGGCCAGTAGACTAATGGTCGTTTCTCGAGAAACGACCATTAGTCTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017998.1-743s1c1
Sequence:CCGGGAGGAATCCTTTGCCTCCTATCTCGAGATAGGAGGCAAAGGATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017998.1-966s1c1
Sequence:CCGGCCAAACCTGAGAAATGAAGAACTCGAGTTCTTCATTTCTCAGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)