EMAIL THIS PAGE TO A FRIEND

C9orf41

chromosome 9 open reading frame 41

38 Gene Product Result for
Species: Human C9orf41(138199)
UniProtKB ID: Q8N4J0, Q7Z383, Q8N7C5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036891 MISSION® esiRNA esiRNA human C9orf41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166049 predicted 1465
2 SASI_Hs01_00166051 predicted 1259
3 SASI_Hs01_00166052 predicted 582
4 SASI_Hs01_00166053 predicted 1315
5 SASI_Hs01_00166054 predicted 633
6 SASI_Hs01_00166055 predicted 642
7 SASI_Hs01_00166056 predicted 855
8 SASI_Hs01_00166057 predicted 919
9 SASI_Hs02_00366151 predicted 1106
10 SASI_Hs02_00366152 predicted 1369
11 SASI_Hs01_00166048 predicted 1109
12 SASI_Hs01_00166050 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152420
VALIDATED
C9orf41 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 41
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152420.1-1180s1c1
Sequence:CCGGCCTCTGCTGTACCACTTTGAACTCGAGTTCAAAGTGGTACAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152420.1-489s21c1
Sequence:CCGGCCGGAAATGCATTGATCATAACTCGAGTTATGATCAATGCATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152420.1-1227s21c1
Sequence:CCGGATTGAGCTATGAGGATATAAACTCGAGTTTATATCCTCATAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-608s21c1
Sequence:CCGGCATTTGACATGGATAAGTTAACTCGAGTTAACTTATCCATGTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-689s21c1
Sequence:CCGGCCTGTTACCAGCCAATCATTACTCGAGTAATGATTGGCTGGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-1709s21c1
Sequence:CCGGTGCCGAATTAATGACTAATAGCTCGAGCTATTAGTCATTAATTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152420
VALIDATED
C9orf41 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 41
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152420.1-1180s1c1
Sequence:CCGGCCTCTGCTGTACCACTTTGAACTCGAGTTCAAAGTGGTACAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152420.1-489s21c1
Sequence:CCGGCCGGAAATGCATTGATCATAACTCGAGTTATGATCAATGCATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152420.1-1227s21c1
Sequence:CCGGATTGAGCTATGAGGATATAAACTCGAGTTTATATCCTCATAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-608s21c1
Sequence:CCGGCATTTGACATGGATAAGTTAACTCGAGTTAACTTATCCATGTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-689s21c1
Sequence:CCGGCCTGTTACCAGCCAATCATTACTCGAGTAATGATTGGCTGGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-1709s21c1
Sequence:CCGGTGCCGAATTAATGACTAATAGCTCGAGCTATTAGTCATTAATTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152420
VALIDATED
C9orf41 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 41
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152420.1-1180s1c1
Sequence:CCGGCCTCTGCTGTACCACTTTGAACTCGAGTTCAAAGTGGTACAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152420.1-489s21c1
Sequence:CCGGCCGGAAATGCATTGATCATAACTCGAGTTATGATCAATGCATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152420.1-1227s21c1
Sequence:CCGGATTGAGCTATGAGGATATAAACTCGAGTTTATATCCTCATAGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-608s21c1
Sequence:CCGGCATTTGACATGGATAAGTTAACTCGAGTTAACTTATCCATGTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-689s21c1
Sequence:CCGGCCTGTTACCAGCCAATCATTACTCGAGTAATGATTGGCTGGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152420.1-1709s21c1
Sequence:CCGGTGCCGAATTAATGACTAATAGCTCGAGCTATTAGTCATTAATTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks