EMAIL THIS PAGE TO A FRIEND

C9orf43

chromosome 9 open reading frame 43

Species: Human C9orf43(257169)
UniProtKB ID: Q8TAL5
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152786 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078771 MISSION® esiRNA esiRNA human C9orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152786 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366729 predicted 936
2 SASI_Hs01_00015278 predicted 1590
3 SASI_Hs01_00015279 predicted 795
4 SASI_Hs01_00015280 predicted 655
5 SASI_Hs01_00015281 predicted 757
6 SASI_Hs01_00015282 predicted 1751
7 SASI_Hs01_00015283 predicted 1571
8 SASI_Hs01_00015285 predicted 783
9 SASI_Hs01_00015286 predicted 766
10 SASI_Hs01_00015287 predicted 518
11 SASI_Hs01_00015284 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152786
C9orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 43
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-1580s21c1
Sequence:CCGGCTACTATGACCATGCGGATTTCTCGAGAAATCCGCATGGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-775s21c1
Sequence:CCGGCTAACAGACTTCCCAAATTTCCTCGAGGAAATTTGGGAAGTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-1421s21c1
Sequence:CCGGGATCCAGAGCACTTCACATAACTCGAGTTATGTGAAGTGCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152786.1-1913s1c1
Sequence:CCGGGCAACGTTTCACATAAGGGCACTCGAGTGCCCTTATGTGAAACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1016s1c1
Sequence:CCGGCCCAGTGCAATTGTCTGAACACTCGAGTGTTCAGACAATTGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1638s1c1
Sequence:CCGGGAACCCACTAACAAGGACATTCTCGAGAATGTCCTTGTTAGTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1374s1c1
Sequence:CCGGCCTATTAAGAAACAGGAGGCTCTCGAGAGCCTCCTGTTTCTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-667s1c1
Sequence:CCGGGTACCTTTACTAAGGCCCATTCTCGAGAATGGGCCTTAGTAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152786
C9orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 43
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-1580s21c1
Sequence:CCGGCTACTATGACCATGCGGATTTCTCGAGAAATCCGCATGGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-775s21c1
Sequence:CCGGCTAACAGACTTCCCAAATTTCCTCGAGGAAATTTGGGAAGTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-1421s21c1
Sequence:CCGGGATCCAGAGCACTTCACATAACTCGAGTTATGTGAAGTGCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152786.1-1913s1c1
Sequence:CCGGGCAACGTTTCACATAAGGGCACTCGAGTGCCCTTATGTGAAACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1016s1c1
Sequence:CCGGCCCAGTGCAATTGTCTGAACACTCGAGTGTTCAGACAATTGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1638s1c1
Sequence:CCGGGAACCCACTAACAAGGACATTCTCGAGAATGTCCTTGTTAGTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1374s1c1
Sequence:CCGGCCTATTAAGAAACAGGAGGCTCTCGAGAGCCTCCTGTTTCTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-667s1c1
Sequence:CCGGGTACCTTTACTAAGGCCCATTCTCGAGAATGGGCCTTAGTAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152786
C9orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 43
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-1580s21c1
Sequence:CCGGCTACTATGACCATGCGGATTTCTCGAGAAATCCGCATGGTCATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-775s21c1
Sequence:CCGGCTAACAGACTTCCCAAATTTCCTCGAGGAAATTTGGGAAGTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152786.1-1421s21c1
Sequence:CCGGGATCCAGAGCACTTCACATAACTCGAGTTATGTGAAGTGCTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152786.1-1913s1c1
Sequence:CCGGGCAACGTTTCACATAAGGGCACTCGAGTGCCCTTATGTGAAACGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1016s1c1
Sequence:CCGGCCCAGTGCAATTGTCTGAACACTCGAGTGTTCAGACAATTGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1638s1c1
Sequence:CCGGGAACCCACTAACAAGGACATTCTCGAGAATGTCCTTGTTAGTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-1374s1c1
Sequence:CCGGCCTATTAAGAAACAGGAGGCTCTCGAGAGCCTCCTGTTTCTTAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152786.1-667s1c1
Sequence:CCGGGTACCTTTACTAAGGCCCATTCTCGAGAATGGGCCTTAGTAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks