EMAIL THIS PAGE TO A FRIEND

C9orf47

chromosome 9 open reading frame 47

Synonyms: C9orf108 bA791O21.3
Species: Human C9orf47(286223)
UniProtKB ID: Q6ZRZ4, B7ZMC7, Q5SQD7, Q7Z568, Q8N1V4
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001938 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096371 MISSION® esiRNA esiRNA human C9orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001938 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086720 predicted 663
2 SASI_Hs01_00086721 predicted 601
3 SASI_Hs01_00086722 predicted 1139
4 SASI_Hs01_00086723 predicted 811
5 SASI_Hs01_00086724 predicted 86
6 SASI_Hs01_00086725 predicted 69
7 SASI_Hs01_00086726 predicted 808
8 SASI_Hs01_00086727 predicted 892
9 SASI_Hs01_00086728 predicted 1120
10 SASI_Hs01_00086729 predicted 187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001938
C9orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 47
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-636s1c1
Sequence:CCGGGTTCGTGGAGAAGTTCCATCACTCGAGTGATGGAACTTCTCCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-2772s1c1
Sequence:CCGGCCAGAGAATCTCTTGTCACTACTCGAGTAGTGACAAGAGATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-3161s1c1
Sequence:CCGGCCCTGTGGAAATCTTGAGAATCTCGAGATTCTCAAGATTTCCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-606s1c1
Sequence:CCGGGCTGAATACCTGGATGAAAGTCTCGAGACTTTCATCCAGGTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-1218s1c1
Sequence:CCGGCCTCCAGAATTAGGCATCATTCTCGAGAATGATGCCTAATTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-609s1c1
Sequence:CCGGGAATACCTGGATGAAAGTGGACTCGAGTCCACTTTCATCCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-643s1c1
Sequence:CCGGGAGAAGTTCCATCAGTCGTTTCTCGAGAAACGACTGATGGAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001938.3-730s21c1
Sequence:CCGGCTTGGACAATTAACAAGTTAGCTCGAGCTAACTTGTTAATTGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001938.3-1073s21c1
Sequence:CCGGTGGACACTCCCAATGGTATATCTCGAGATATACCATTGGGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001938.3-160s21c1
Sequence:CCGGGATAGTATTAATCCTCCTATTCTCGAGAATAGGAGGATTAATACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001938
C9orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 47
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-636s1c1
Sequence:CCGGGTTCGTGGAGAAGTTCCATCACTCGAGTGATGGAACTTCTCCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-2772s1c1
Sequence:CCGGCCAGAGAATCTCTTGTCACTACTCGAGTAGTGACAAGAGATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-3161s1c1
Sequence:CCGGCCCTGTGGAAATCTTGAGAATCTCGAGATTCTCAAGATTTCCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-606s1c1
Sequence:CCGGGCTGAATACCTGGATGAAAGTCTCGAGACTTTCATCCAGGTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-1218s1c1
Sequence:CCGGCCTCCAGAATTAGGCATCATTCTCGAGAATGATGCCTAATTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-609s1c1
Sequence:CCGGGAATACCTGGATGAAAGTGGACTCGAGTCCACTTTCATCCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-643s1c1
Sequence:CCGGGAGAAGTTCCATCAGTCGTTTCTCGAGAAACGACTGATGGAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001938.3-730s21c1
Sequence:CCGGCTTGGACAATTAACAAGTTAGCTCGAGCTAACTTGTTAATTGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001938.3-1073s21c1
Sequence:CCGGTGGACACTCCCAATGGTATATCTCGAGATATACCATTGGGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001938.3-160s21c1
Sequence:CCGGGATAGTATTAATCCTCCTATTCTCGAGAATAGGAGGATTAATACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001938
C9orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 47
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-636s1c1
Sequence:CCGGGTTCGTGGAGAAGTTCCATCACTCGAGTGATGGAACTTCTCCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-2772s1c1
Sequence:CCGGCCAGAGAATCTCTTGTCACTACTCGAGTAGTGACAAGAGATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-3161s1c1
Sequence:CCGGCCCTGTGGAAATCTTGAGAATCTCGAGATTCTCAAGATTTCCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-606s1c1
Sequence:CCGGGCTGAATACCTGGATGAAAGTCTCGAGACTTTCATCCAGGTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001938.1-1218s1c1
Sequence:CCGGCCTCCAGAATTAGGCATCATTCTCGAGAATGATGCCTAATTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-609s1c1
Sequence:CCGGGAATACCTGGATGAAAGTGGACTCGAGTCCACTTTCATCCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001938.1-643s1c1
Sequence:CCGGGAGAAGTTCCATCAGTCGTTTCTCGAGAAACGACTGATGGAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001938.3-730s21c1
Sequence:CCGGCTTGGACAATTAACAAGTTAGCTCGAGCTAACTTGTTAATTGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001938.3-1073s21c1
Sequence:CCGGTGGACACTCCCAATGGTATATCTCGAGATATACCATTGGGAGTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001938.3-160s21c1
Sequence:CCGGGATAGTATTAATCCTCCTATTCTCGAGAATAGGAGGATTAATACTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks