EMAIL THIS PAGE TO A FRIEND

C9orf50

chromosome 9 open reading frame 50

21 Gene Product Result for
Species: Human C9orf50(375759)
UniProtKB ID: Q5SZB4, Q2M1I2, Q8NA65
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199350 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199350 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114656 predicted 1340
2 SASI_Hs02_00372789 predicted 1086
3 SASI_Hs01_00114658 predicted 868
4 SASI_Hs01_00114659 predicted 889
5 SASI_Hs01_00114660 predicted 1021
6 SASI_Hs01_00114661 predicted 870
7 SASI_Hs01_00114662 predicted 1243
8 SASI_Hs01_00114663 predicted 1135
9 SASI_Hs02_00372790 predicted 894
10 SASI_Hs01_00114664 predicted 999
11 SASI_Hs01_00114657 predicted 1282
12 SASI_Hs01_00114665 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199350
C9orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 50
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-874s21c1
Sequence:CCGGGAAGGGTGATCACTCACAATTCTCGAGAATTGTGAGTGATCACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-844s21c1
Sequence:CCGGGCTCCAGCAGACACCTATTCTCTCGAGAGAATAGGTGTCTGCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1257s21c1
Sequence:CCGGAGACACAGGGCTACCTTTCTGCTCGAGCAGAAAGGTAGCCCTGTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1168s21c1
Sequence:CCGGGAGTTTGCCCAAAGCCCTGTACTCGAGTACAGGGCTTTGGGCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1471s21c1
Sequence:CCGGCGCAACACTGCAGCCAGATAACTCGAGTTATCTGGCTGCAGTGTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-817s1c1
Sequence:CCGGCCTCCAGGATAGTCTTACGAACTCGAGTTCGTAAGACTATCCTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-775s1c1
Sequence:CCGGCAACTGTTCATTCCTCCCAGACTCGAGTCTGGGAGGAATGAACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-872s1c1
Sequence:CCGGCTGAAGGGTGATCACTCACAACTCGAGTTGTGAGTGATCACCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-769s1c1
Sequence:CCGGGTGTCCCAACTGTTCATTCCTCTCGAGAGGAATGAACAGTTGGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-821s1c1
Sequence:CCGGCAGGATAGTCTTACGAAGATTCTCGAGAATCTTCGTAAGACTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-888s1c1
Sequence:CCGGCACAATTCACCACTGTCAGAACTCGAGTTCTGACAGTGGTGAATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-1090s1c1
Sequence:CCGGGAGCGTCATTGTGAACCAGAACTCGAGTTCTGGTTCACAATGACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199350
C9orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 50
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-874s21c1
Sequence:CCGGGAAGGGTGATCACTCACAATTCTCGAGAATTGTGAGTGATCACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-844s21c1
Sequence:CCGGGCTCCAGCAGACACCTATTCTCTCGAGAGAATAGGTGTCTGCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1257s21c1
Sequence:CCGGAGACACAGGGCTACCTTTCTGCTCGAGCAGAAAGGTAGCCCTGTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1168s21c1
Sequence:CCGGGAGTTTGCCCAAAGCCCTGTACTCGAGTACAGGGCTTTGGGCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1471s21c1
Sequence:CCGGCGCAACACTGCAGCCAGATAACTCGAGTTATCTGGCTGCAGTGTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-817s1c1
Sequence:CCGGCCTCCAGGATAGTCTTACGAACTCGAGTTCGTAAGACTATCCTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-775s1c1
Sequence:CCGGCAACTGTTCATTCCTCCCAGACTCGAGTCTGGGAGGAATGAACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-872s1c1
Sequence:CCGGCTGAAGGGTGATCACTCACAACTCGAGTTGTGAGTGATCACCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-769s1c1
Sequence:CCGGGTGTCCCAACTGTTCATTCCTCTCGAGAGGAATGAACAGTTGGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-821s1c1
Sequence:CCGGCAGGATAGTCTTACGAAGATTCTCGAGAATCTTCGTAAGACTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-888s1c1
Sequence:CCGGCACAATTCACCACTGTCAGAACTCGAGTTCTGACAGTGGTGAATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-1090s1c1
Sequence:CCGGGAGCGTCATTGTGAACCAGAACTCGAGTTCTGGTTCACAATGACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199350
C9orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 50
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-874s21c1
Sequence:CCGGGAAGGGTGATCACTCACAATTCTCGAGAATTGTGAGTGATCACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-844s21c1
Sequence:CCGGGCTCCAGCAGACACCTATTCTCTCGAGAGAATAGGTGTCTGCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1257s21c1
Sequence:CCGGAGACACAGGGCTACCTTTCTGCTCGAGCAGAAAGGTAGCCCTGTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1168s21c1
Sequence:CCGGGAGTTTGCCCAAAGCCCTGTACTCGAGTACAGGGCTTTGGGCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199350.3-1471s21c1
Sequence:CCGGCGCAACACTGCAGCCAGATAACTCGAGTTATCTGGCTGCAGTGTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-817s1c1
Sequence:CCGGCCTCCAGGATAGTCTTACGAACTCGAGTTCGTAAGACTATCCTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-775s1c1
Sequence:CCGGCAACTGTTCATTCCTCCCAGACTCGAGTCTGGGAGGAATGAACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-872s1c1
Sequence:CCGGCTGAAGGGTGATCACTCACAACTCGAGTTGTGAGTGATCACCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-769s1c1
Sequence:CCGGGTGTCCCAACTGTTCATTCCTCTCGAGAGGAATGAACAGTTGGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-821s1c1
Sequence:CCGGCAGGATAGTCTTACGAAGATTCTCGAGAATCTTCGTAAGACTATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-888s1c1
Sequence:CCGGCACAATTCACCACTGTCAGAACTCGAGTTCTGACAGTGGTGAATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199350.1-1090s1c1
Sequence:CCGGGAGCGTCATTGTGAACCAGAACTCGAGTTCTGGTTCACAATGACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)