EMAIL THIS PAGE TO A FRIEND

C9orf53

chromosome 9 open reading frame 53

33 Gene Product Result for
Synonyms: bA149I2.3
Species: Human C9orf53(51198)
UniProtKB ID: Q9UH64, Q5VVJ4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016349 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231751 MISSION® esiRNA esiRNA targeting human C9orf53 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723106 Rosetta Predictions human pricing
XM_001725384 Rosetta Predictions human pricing
XM_928057 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00453275 predicted 312
2 SASI_Hs02_00453276 predicted 17
3 SASI_Hs02_00453277 predicted 345
4 SASI_Hs02_00453278 predicted 197
5 SASI_Hs02_00453279 predicted 317
6 SASI_Hs02_00453280 predicted 255
7 SASI_Hs02_00453281 predicted 290
8 SASI_Hs02_00453282 predicted 282
9 SASI_Hs02_00453283 predicted 372
10 SASI_Hs02_00453284 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467402 predicted 310
2 SASI_Hs02_00467403 predicted 24
3 SASI_Hs02_00467404 predicted 338
4 SASI_Hs02_00467405 predicted 415
5 SASI_Hs02_00467406 predicted 504
6 SASI_Hs02_00467407 predicted 188
7 SASI_Hs02_00467408 predicted 498
8 SASI_Hs02_00467409 predicted 310
9 SASI_Hs02_00467410 predicted 469
10 SASI_Hs02_00467411 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269579 predicted 257
2 SASI_Hs01_00269580 predicted 242
3 SASI_Hs01_00269581 predicted 238
4 SASI_Hs01_00269582 predicted 232
5 SASI_Hs01_00269583 predicted 232
6 SASI_Hs01_00269584 predicted 244
7 SASI_Hs01_00269585 predicted 242
8 SASI_Hs01_00269586 predicted 234
9 SASI_Hs01_00269587 predicted 269
10 SASI_Hs01_00269588 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016349
C9orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 53
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016349.1-369s1c1
Sequence:CCGGCCGGATAAATACGGATCTCCACTCGAGTGGAGATCCGTATTTATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-142s1c1
Sequence:CCGGCAATCCCACTGTGGCAGAGAACTCGAGTTCTCTGCCACAGTGGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-293s1c1
Sequence:CCGGGTTGGCTGGATTCAGTTACCTCTCGAGAGGTAACTGAATCCAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-163s1c1
Sequence:CCGGCCGCAGAGTTCCTTCCGGTTTCTCGAGAAACCGGAAGGAACTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-264s1c1
Sequence:CCGGCGAGTCGGATTCCGAGACTATCTCGAGATAGTCTCGGAATCCGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016349
C9orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 53
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016349.1-369s1c1
Sequence:CCGGCCGGATAAATACGGATCTCCACTCGAGTGGAGATCCGTATTTATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-142s1c1
Sequence:CCGGCAATCCCACTGTGGCAGAGAACTCGAGTTCTCTGCCACAGTGGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-293s1c1
Sequence:CCGGGTTGGCTGGATTCAGTTACCTCTCGAGAGGTAACTGAATCCAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-163s1c1
Sequence:CCGGCCGCAGAGTTCCTTCCGGTTTCTCGAGAAACCGGAAGGAACTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-264s1c1
Sequence:CCGGCGAGTCGGATTCCGAGACTATCTCGAGATAGTCTCGGAATCCGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016349
C9orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 53
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016349.1-369s1c1
Sequence:CCGGCCGGATAAATACGGATCTCCACTCGAGTGGAGATCCGTATTTATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-142s1c1
Sequence:CCGGCAATCCCACTGTGGCAGAGAACTCGAGTTCTCTGCCACAGTGGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-293s1c1
Sequence:CCGGGTTGGCTGGATTCAGTTACCTCTCGAGAGGTAACTGAATCCAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-163s1c1
Sequence:CCGGCCGCAGAGTTCCTTCCGGTTTCTCGAGAAACCGGAAGGAACTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016349.1-264s1c1
Sequence:CCGGCGAGTCGGATTCCGAGACTATCTCGAGATAGTCTCGGAATCCGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks