EMAIL THIS PAGE TO A FRIEND

C9orf57

chromosome 9 open reading frame 57

53 Gene Product Result for
Synonyms: RP11-346E17.3
Species: Human C9orf57(138240)
UniProtKB ID: Q5W0N0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128618 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102851 MISSION® esiRNA esiRNA human C9orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_059954 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296872 predicted 1125
2 SASI_Hs01_00296873 predicted 1120
3 SASI_Hs01_00296874 predicted 1124
4 SASI_Hs01_00296875 predicted 1123
5 SASI_Hs01_00296876 predicted 535
6 SASI_Hs01_00296877 predicted 727
7 SASI_Hs01_00296878 predicted 508
8 SASI_Hs01_00296879 predicted 633
9 SASI_Hs01_00296880 predicted 390
10 SASI_Hs01_00296881 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128618
C9orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 57
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-195s21c1
Sequence:CCGGATTCCGCCTCTTAGGTGTTATCTCGAGATAACACCTAAGAGGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-582s21c1
Sequence:CCGGAGTCAGTGGCCCATATCTAAACTCGAGTTTAGATATGGGCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-441s21c1
Sequence:CCGGAGGTGGCATTCAATGGTATTCCTCGAGGAATACCATTGAATGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128618.1-1211s21c1
Sequence:CCGGTACCTTAACCATGCCTAAATGCTCGAGCATTTAGGCATGGTTAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128618
C9orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 57
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-195s21c1
Sequence:CCGGATTCCGCCTCTTAGGTGTTATCTCGAGATAACACCTAAGAGGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-582s21c1
Sequence:CCGGAGTCAGTGGCCCATATCTAAACTCGAGTTTAGATATGGGCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-441s21c1
Sequence:CCGGAGGTGGCATTCAATGGTATTCCTCGAGGAATACCATTGAATGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128618.1-1211s21c1
Sequence:CCGGTACCTTAACCATGCCTAAATGCTCGAGCATTTAGGCATGGTTAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128618
C9orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 57
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-195s21c1
Sequence:CCGGATTCCGCCTCTTAGGTGTTATCTCGAGATAACACCTAAGAGGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-582s21c1
Sequence:CCGGAGTCAGTGGCCCATATCTAAACTCGAGTTTAGATATGGGCCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128618.1-441s21c1
Sequence:CCGGAGGTGGCATTCAATGGTATTCCTCGAGGAATACCATTGAATGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128618.1-1211s21c1
Sequence:CCGGTACCTTAACCATGCCTAAATGCTCGAGCATTTAGGCATGGTTAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks