EMAIL THIS PAGE TO A FRIEND

C9orf64

chromosome 9 open reading frame 64

Species: Human C9orf64(84267)
UniProtKB ID: Q5T6V5, B2RPI6, Q8N2B1, Q9BT18
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032307 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043861 MISSION® esiRNA esiRNA human C9orf64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032307 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359652 predicted 276
2 SASI_Hs01_00183788 predicted 765
3 SASI_Hs01_00183789 predicted 768
4 SASI_Hs01_00183791 predicted 1116
5 SASI_Hs01_00183793 predicted 872
6 SASI_Hs01_00183794 predicted 871
7 SASI_Hs02_00359653 predicted 960
8 SASI_Hs02_00359654 predicted 440
9 SASI_Hs02_00359655 predicted 765
10 SASI_Hs02_00359656 predicted 978
11 SASI_Hs01_00183785 predicted 710
12 SASI_Hs01_00183786 predicted 540
13 SASI_Hs01_00183787 predicted 544
14 SASI_Hs01_00183790 predicted 553
15 SASI_Hs01_00183792 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032307
VALIDATED
C9orf64 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 64
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000147586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032307.2-715s1c1
Sequence:CCGGGATTGTCTTCTGGAGCTTATTCTCGAGAATAAGCTCCAGAAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032307.2-633s1c1
Sequence:CCGGCAAAGGAGAAATGCTCTCATACTCGAGTATGAGAGCATTTCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032307.2-1483s1c1
Sequence:CCGGCACGCTCTGTAATCCCAAATACTCGAGTATTTGGGATTACAGAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032307.2-1645s1c1
Sequence:CCGGCGCTATGTATTCCCAACTTTACTCGAGTAAAGTTGGGAATACATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032307
VALIDATED
C9orf64 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 64
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000147586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032307.2-715s1c1
Sequence:CCGGGATTGTCTTCTGGAGCTTATTCTCGAGAATAAGCTCCAGAAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032307.2-633s1c1
Sequence:CCGGCAAAGGAGAAATGCTCTCATACTCGAGTATGAGAGCATTTCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032307.2-1483s1c1
Sequence:CCGGCACGCTCTGTAATCCCAAATACTCGAGTATTTGGGATTACAGAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032307.2-1645s1c1
Sequence:CCGGCGCTATGTATTCCCAACTTTACTCGAGTAAAGTTGGGAATACATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032307
VALIDATED
C9orf64 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 64
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000147586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032307.2-715s1c1
Sequence:CCGGGATTGTCTTCTGGAGCTTATTCTCGAGAATAAGCTCCAGAAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032307.2-633s1c1
Sequence:CCGGCAAAGGAGAAATGCTCTCATACTCGAGTATGAGAGCATTTCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032307.2-1483s1c1
Sequence:CCGGCACGCTCTGTAATCCCAAATACTCGAGTATTTGGGATTACAGAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032307.2-1645s1c1
Sequence:CCGGCGCTATGTATTCCCAACTTTACTCGAGTAAAGTTGGGAATACATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks