EMAIL THIS PAGE TO A FRIEND

C9orf66

chromosome 9 open reading frame 66

16 Gene Product Result for
Synonyms: RP11-59O6.1
Species: Human C9orf66(157983)
UniProtKB ID: Q5T8R8, Q96NB0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152569 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025234 predicted 738
2 SASI_Hs01_00025235 predicted 869
3 SASI_Hs01_00025236 predicted 1012
4 SASI_Hs01_00025237 predicted 346
5 SASI_Hs01_00025238 predicted 769
6 SASI_Hs01_00025239 predicted 599
7 SASI_Hs01_00025240 predicted 380
8 SASI_Hs01_00025241 predicted 366
9 SASI_Hs01_00025242 predicted 888
10 SASI_Hs01_00025243 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152569
C9orf66 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 66
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1631s1c1
Sequence:CCGGGCTGCTCTAACCTGTGCTATACTCGAGTATAGCACAGGTTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-704s1c1
Sequence:CCGGGCGTCTTACCTGTTGATCTTGCTCGAGCAAGATCAACAGGTAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1501s1c1
Sequence:CCGGGCGTCCAGGTTTATTTCAGTTCTCGAGAACTGAAATAAACCTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1681s1c1
Sequence:CCGGCCATTTACCAACTTGCTCTTACTCGAGTAAGAGCAAGTTGGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1502s1c1
Sequence:CCGGCGTCCAGGTTTATTTCAGTTTCTCGAGAAACTGAAATAAACCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-706s1c1
Sequence:CCGGGTCTTACCTGTTGATCTTGAGCTCGAGCTCAAGATCAACAGGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-705s1c1
Sequence:CCGGCGTCTTACCTGTTGATCTTGACTCGAGTCAAGATCAACAGGTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-899s1c1
Sequence:CCGGCATTTCCACCTTCTAAGCCGACTCGAGTCGGCTTAGAAGGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-886s1c1
Sequence:CCGGCTGGAAACTTCCGCATTTCCACTCGAGTGGAAATGCGGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152569
C9orf66 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 66
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1631s1c1
Sequence:CCGGGCTGCTCTAACCTGTGCTATACTCGAGTATAGCACAGGTTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-704s1c1
Sequence:CCGGGCGTCTTACCTGTTGATCTTGCTCGAGCAAGATCAACAGGTAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1501s1c1
Sequence:CCGGGCGTCCAGGTTTATTTCAGTTCTCGAGAACTGAAATAAACCTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1681s1c1
Sequence:CCGGCCATTTACCAACTTGCTCTTACTCGAGTAAGAGCAAGTTGGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1502s1c1
Sequence:CCGGCGTCCAGGTTTATTTCAGTTTCTCGAGAAACTGAAATAAACCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-706s1c1
Sequence:CCGGGTCTTACCTGTTGATCTTGAGCTCGAGCTCAAGATCAACAGGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-705s1c1
Sequence:CCGGCGTCTTACCTGTTGATCTTGACTCGAGTCAAGATCAACAGGTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-899s1c1
Sequence:CCGGCATTTCCACCTTCTAAGCCGACTCGAGTCGGCTTAGAAGGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-886s1c1
Sequence:CCGGCTGGAAACTTCCGCATTTCCACTCGAGTGGAAATGCGGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152569
C9orf66 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 66
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1631s1c1
Sequence:CCGGGCTGCTCTAACCTGTGCTATACTCGAGTATAGCACAGGTTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-704s1c1
Sequence:CCGGGCGTCTTACCTGTTGATCTTGCTCGAGCAAGATCAACAGGTAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163130    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1501s1c1
Sequence:CCGGGCGTCCAGGTTTATTTCAGTTCTCGAGAACTGAAATAAACCTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1681s1c1
Sequence:CCGGCCATTTACCAACTTGCTCTTACTCGAGTAAGAGCAAGTTGGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152569.1-1502s1c1
Sequence:CCGGCGTCCAGGTTTATTTCAGTTTCTCGAGAAACTGAAATAAACCTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-706s1c1
Sequence:CCGGGTCTTACCTGTTGATCTTGAGCTCGAGCTCAAGATCAACAGGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-705s1c1
Sequence:CCGGCGTCTTACCTGTTGATCTTGACTCGAGTCAAGATCAACAGGTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-899s1c1
Sequence:CCGGCATTTCCACCTTCTAAGCCGACTCGAGTCGGCTTAGAAGGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152569.1-886s1c1
Sequence:CCGGCTGGAAACTTCCGCATTTCCACTCGAGTGGAAATGCGGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks