EMAIL THIS PAGE TO A FRIEND

C9orf69

chromosome 9 open reading frame 69

Synonyms: bA83N9.1
Species: Human C9orf69(90120)
UniProtKB ID: H0YL14
Gene ID:
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA066070 Anti-C9orf69 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152833 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152833 Rosetta Predictions human pricing
XM_926364 Rosetta Predictions human pricing
XM_931218 Rosetta Predictions human pricing
XM_931227 Rosetta Predictions human pricing
XM_931232 Rosetta Predictions human pricing
XM_931237 Rosetta Predictions human pricing
XM_931243 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366755 predicted 747
2 SASI_Hs02_00366756 predicted 2198
3 SASI_Hs02_00366757 predicted 1717
4 SASI_Hs02_00366758 predicted 1790
5 SASI_Hs02_00366759 predicted 1787
6 SASI_Hs02_00366760 predicted 1962
7 SASI_Hs02_00366761 predicted 2797
8 SASI_Hs02_00366762 predicted 1801
9 SASI_Hs02_00366763 predicted 2246
10 SASI_Hs02_00366764 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266842 predicted 1064
2 SASI_Hs01_00266843 predicted 1709
3 SASI_Hs01_00266844 predicted 2520
4 SASI_Hs01_00266845 predicted 2035
5 SASI_Hs01_00266846 predicted 2109
6 SASI_Hs01_00266847 predicted 2116
7 SASI_Hs01_00266848 predicted 2289
8 SASI_Hs01_00266849 predicted 3112
9 SASI_Hs01_00266850 predicted 2561
10 SASI_Hs01_00266851 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297302 predicted 866
2 SASI_Hs01_00297303 predicted 1519
3 SASI_Hs01_00297304 predicted 2327
4 SASI_Hs01_00297305 predicted 1843
5 SASI_Hs01_00297306 predicted 1913
6 SASI_Hs01_00297307 predicted 1913
7 SASI_Hs01_00297308 predicted 2087
8 SASI_Hs01_00297309 predicted 2921
9 SASI_Hs01_00297310 predicted 2369
10 SASI_Hs01_00297311 predicted 2064
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257783 predicted 722
2 SASI_Hs01_00257784 predicted 1361
3 SASI_Hs01_00257785 predicted 2176
4 SASI_Hs01_00257786 predicted 1694
5 SASI_Hs01_00257787 predicted 1766
6 SASI_Hs01_00257788 predicted 1770
7 SASI_Hs01_00257789 predicted 1937
8 SASI_Hs01_00257790 predicted 2770
9 SASI_Hs01_00257791 predicted 2216
10 SASI_Hs01_00257792 predicted 1915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291673 predicted 1361
2 SASI_Hs01_00291674 predicted 1170
3 SASI_Hs01_00291675 predicted 1398
4 SASI_Hs01_00291676 predicted 2263
5 SASI_Hs01_00291677 predicted 1764
6 SASI_Hs01_00291678 predicted 2118
7 SASI_Hs01_00291679 predicted 1531
8 SASI_Hs01_00291680 predicted 2055
9 SASI_Hs01_00291681 predicted 1680
10 SASI_Hs01_00291682 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271648 predicted 1368
2 SASI_Hs01_00271649 predicted 1163
3 SASI_Hs01_00271650 predicted 1290
4 SASI_Hs01_00271651 predicted 2260
5 SASI_Hs01_00271652 predicted 1659
6 SASI_Hs01_00271653 predicted 1717
7 SASI_Hs01_00271654 predicted 1426
8 SASI_Hs01_00271655 predicted 2104
9 SASI_Hs01_00271656 predicted 1901
10 SASI_Hs01_00271657 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285180 predicted 416
2 SASI_Hs01_00285181 predicted 1060
3 SASI_Hs01_00285182 predicted 1867
4 SASI_Hs01_00285183 predicted 1385
5 SASI_Hs01_00285184 predicted 1469
6 SASI_Hs01_00285185 predicted 1468
7 SASI_Hs01_00285186 predicted 1636
8 SASI_Hs01_00285187 predicted 2464
9 SASI_Hs01_00285188 predicted 1921
10 SASI_Hs01_00285189 predicted 1602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152833
VALIDATED
C9orf69 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 69
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-2447s21c1
Sequence:CCGGGTAAACCGTGCTCTCTAATTTCTCGAGAAATTAGAGAGCACGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-639s21c1
Sequence:CCGGCAACAACTTCGACGTGTACATCTCGAGATGTACACGTCGAAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-857s21c1
Sequence:CCGGTGAACGAGCTGCTCGTCTATGCTCGAGCATAGACGAGCAGCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-686s21c1
Sequence:CCGGTCCGCTTCCTACTCTACTTTACTCGAGTAAAGTAGAGTAGGAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-750s21c1
Sequence:CCGGCCTCTTCTGCCTACAGTACCTCTCGAGAGGTACTGTAGGCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152833
VALIDATED
C9orf69 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 69
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-2447s21c1
Sequence:CCGGGTAAACCGTGCTCTCTAATTTCTCGAGAAATTAGAGAGCACGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-639s21c1
Sequence:CCGGCAACAACTTCGACGTGTACATCTCGAGATGTACACGTCGAAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-857s21c1
Sequence:CCGGTGAACGAGCTGCTCGTCTATGCTCGAGCATAGACGAGCAGCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-686s21c1
Sequence:CCGGTCCGCTTCCTACTCTACTTTACTCGAGTAAAGTAGAGTAGGAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-750s21c1
Sequence:CCGGCCTCTTCTGCCTACAGTACCTCTCGAGAGGTACTGTAGGCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152833
VALIDATED
C9orf69 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 69
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-2447s21c1
Sequence:CCGGGTAAACCGTGCTCTCTAATTTCTCGAGAAATTAGAGAGCACGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-639s21c1
Sequence:CCGGCAACAACTTCGACGTGTACATCTCGAGATGTACACGTCGAAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-857s21c1
Sequence:CCGGTGAACGAGCTGCTCGTCTATGCTCGAGCATAGACGAGCAGCTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-686s21c1
Sequence:CCGGTCCGCTTCCTACTCTACTTTACTCGAGTAAAGTAGAGTAGGAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152833.2-750s21c1
Sequence:CCGGCCTCTTCTGCCTACAGTACCTCTCGAGAGGTACTGTAGGCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks