EMAIL THIS PAGE TO A FRIEND

C9orf72

chromosome 9 open reading frame 72

139 Gene Product Result for
Synonyms: ALSFTD FTDALS
UniProtKB ID: Q96LT7, A8K5W0, D3DRK6, G8I0B6, Q6NUS9
Gene ID:
Human(203228) Summary: Expansion of a hexanucleotide repeat in non-coding sequence between alternate 5' exons in transcripts from this gene is associated with 9p-linked ALS (amyotrophic lateral sclerosis) and FTD (frontotemporal dementia) (PMID: 21944778, 21944779). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
chicken(427370) chromosome Z open reading frame, human C9orf72
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018325 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075861 MISSION® esiRNA esiRNA human C9orf72 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
ABN736 Anti-C9orf72 Antibody 100 µL, Anti-C9orf72 Antibody, Cat. No. ABN736, is a highly specific rabbit polyclonal antibody, that targets C9orf72 and has been tested in Immunohistochemistry. pricing
ABN1357 Anti-C9ORF72/C9RANT (GPsense-CT) 100 µL, Anti-C9ORF72/C9RANT (GPsense-CT), Cat. No. ABN1357, is a highly specific rabbit polyclonal antibody that targets C9ORF72 ( -GP sense, CT) and has been tested in Immunocytochemistry, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
MABN1790 Anti-C9ORF72/C9RANT (poly-AP) Antibody, clone 14E2 100 μg, Anti-C9ORF72 Antibody, clone 14E2 is an antibody against C9RANT (poly-AP) for use in Western Blotting, Immunocytochemistry. pricing
MABN889 Anti-C9ORF72/C9RANT (poly-GA) Antibody, clone 5E9 50 µL, Detect C9ORF72/C9RANT using this Anti-C9ORF72/C9RANT, clone 5E9 Antibody validated for use in Western Blotting and Immunohistochemistry. pricing
ABN1358 Anti-C9ORF72/C9RANT (Poly-GP sense/antisense) 100 µL, Anti-C9ORF72/C9RANT (Poly-GP sense/antisense), Cat. No. ABN1358, is a highly specific rabbit polyclonal antibody that targets C9ORF72 ( -GP sense antisense) and has been tested in Immunofluorescence, Immunohistochemistry, Immunocytochemistry, and Western Blotting. pricing
ABN1361 Anti-C9ORF72/C9RANT (Poly-GR) 100 µL, Anti-C9ORF72/C9RANT (Poly-GR), Cat. No. ABN1361, is a highly specific rabbit polyclonal antibody that targets C9ORF72 ( -GR sense) and has been tested in Immunofluorescence, Immunohistochemistry, Immunocytochemistry, and Western Blotting. pricing
ABN1356 Anti-C9ORF72/C9RANT (poly-PA) 100 µL, Anti-C9ORF72/C9RANT (poly-PA), Cat. No. ABN1356, is a highly specific rabbit polyclonal antibody that targets C9ORF72(poly-PA) and has been tested in Dot Blot, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
ABN1354 Anti-C9ORF72/C9RANT (Poly-PR) 100 µL, Anti-C9ORF72/C9RANT (Poly-PR), Cat. No. ABN1354, is a highly specific rabbit polyclonal antibody, that targets C9ORF72 (alpha-PR antisense) and has been tested in Dot Blot, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
ABN1353 Anti-C9ORF72/C9RANT (PR-CT) 100 µL, Anti-C9ORF72/C9RANT (PR-CT), Cat. No. ABN1353, is a highly specific rabbit polyclonal antibody that targets C9ORF72 (p-PR-Ct) and has been tested in Dot Blot, Immunofluorescence, Immunohistochemistry and Western Blotting. pricing
ABN1360 Anti-C9ORF72 (α-GR sense Antibody, CT) 100 µL, Anti-C9ORF72 (alpha-GR sense, CT), Cat. No. ABN1360, is a highly specific rabbit polyclonal antibody that targets C9ORF72(alpha-GR sense, CT) and has been tested in Dot Blot, Immunocytochemistry, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
ABN1645 Anti-C9ORF72 (long form) 100 μg, Anti-C9ORF72 (long form) Antibody, Cat. No. ABN1645, is a highly specific rabbit polyclonal antibody that targets C9ORF72 and has been tested in Immunofluorescence, Immunohistochemistry, and Immunoprecipitation, and Western Blotting. pricing
ABN1644 Anti-C9orf72 (short form) 100 μg, Anti-C9ORF72 (short form), Cat. No. ABN1644, is a highly specific rabbit polyclonal antibody that targets short isoform of C9orf72 protein and has been tested in Immunofluorescence, Immunohistochemistry, Immunoprecipitation, and Western Blotting. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018325 Rosetta Predictions human pricing
NM_145005 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175386 predicted 479
2 SASI_Hs01_00175388 predicted 324
3 SASI_Hs01_00175389 predicted 317
4 SASI_Hs01_00175390 predicted 468
5 SASI_Hs01_00175391 predicted 481
6 SASI_Hs01_00175392 predicted 405
7 SASI_Hs01_00175393 predicted 407
8 SASI_Hs02_00351760 predicted 466
9 SASI_Hs01_00175394 predicted 481
10 SASI_Hs01_00175395 predicted 323
11 SASI_Hs01_00175387 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155499 predicted 485
2 SASI_Hs01_00155501 predicted 325
3 SASI_Hs01_00155502 predicted 319
4 SASI_Hs01_00155503 predicted 478
5 SASI_Hs01_00155504 predicted 491
6 SASI_Hs01_00155505 predicted 420
7 SASI_Hs01_00155506 predicted 416
8 SASI_Hs02_00364845 predicted 479
9 SASI_Hs01_00155507 predicted 490
10 SASI_Hs01_00155508 predicted 324
11 SASI_Hs01_00155500 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018325
C9orf72 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 72
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-880s1c1
Sequence:CCGGCCAGGTTATGTGAAGCAGAATCTCGAGATTCTGCTTCACATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-755s1c1
Sequence:CCGGCAATGCCATCAGCTCACACTTCTCGAGAAGTGTGAGCTGATGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018325.1-2112s1c1
Sequence:CCGGCCTGGGATTCAGTCTGTAGAACTCGAGTTCTACAGACTGAATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018325.1-2004s1c1
Sequence:CCGGCCACAGAAAGAAAGTGAGCTTCTCGAGAAGCTCACTTTCTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018325.1-980s1c1
Sequence:CCGGGCAAGTCATGTATGCTCCATACTCGAGTATGGAGCATACATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-468s1c1
Sequence:CCGGCCACTTCATAGAGTGTGTGTTCTCGAGAACACACACTCTATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018325.1-129s1c1
Sequence:CCGGGCCAAGACAGAGATTGCTTTACTCGAGTAAAGCAATCTCTGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-1163s1c1
Sequence:CCGGCGAAAGCTTTACTCCTGATTTCTCGAGAAATCAGGAGTAAAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018325.1-2968s1c1
Sequence:CCGGCCACTGAACTAGATGACTGTTCTCGAGAACAGTCATCTAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018325
C9orf72 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 72
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-880s1c1
Sequence:CCGGCCAGGTTATGTGAAGCAGAATCTCGAGATTCTGCTTCACATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-755s1c1
Sequence:CCGGCAATGCCATCAGCTCACACTTCTCGAGAAGTGTGAGCTGATGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018325.1-2112s1c1
Sequence:CCGGCCTGGGATTCAGTCTGTAGAACTCGAGTTCTACAGACTGAATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018325.1-2004s1c1
Sequence:CCGGCCACAGAAAGAAAGTGAGCTTCTCGAGAAGCTCACTTTCTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018325.1-980s1c1
Sequence:CCGGGCAAGTCATGTATGCTCCATACTCGAGTATGGAGCATACATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-468s1c1
Sequence:CCGGCCACTTCATAGAGTGTGTGTTCTCGAGAACACACACTCTATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018325.1-129s1c1
Sequence:CCGGGCCAAGACAGAGATTGCTTTACTCGAGTAAAGCAATCTCTGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-1163s1c1
Sequence:CCGGCGAAAGCTTTACTCCTGATTTCTCGAGAAATCAGGAGTAAAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018325.1-2968s1c1
Sequence:CCGGCCACTGAACTAGATGACTGTTCTCGAGAACAGTCATCTAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018325
C9orf72 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 72
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-880s1c1
Sequence:CCGGCCAGGTTATGTGAAGCAGAATCTCGAGATTCTGCTTCACATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-755s1c1
Sequence:CCGGCAATGCCATCAGCTCACACTTCTCGAGAAGTGTGAGCTGATGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018325.1-2112s1c1
Sequence:CCGGCCTGGGATTCAGTCTGTAGAACTCGAGTTCTACAGACTGAATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130180    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018325.1-2004s1c1
Sequence:CCGGCCACAGAAAGAAAGTGAGCTTCTCGAGAAGCTCACTTTCTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018325.1-980s1c1
Sequence:CCGGGCAAGTCATGTATGCTCCATACTCGAGTATGGAGCATACATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-468s1c1
Sequence:CCGGCCACTTCATAGAGTGTGTGTTCTCGAGAACACACACTCTATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018325.1-129s1c1
Sequence:CCGGGCCAAGACAGAGATTGCTTTACTCGAGTAAAGCAATCTCTGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018325.1-1163s1c1
Sequence:CCGGCGAAAGCTTTACTCCTGATTTCTCGAGAAATCAGGAGTAAAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018325.1-2968s1c1
Sequence:CCGGCCACTGAACTAGATGACTGTTCTCGAGAACAGTCATCTAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks