EMAIL THIS PAGE TO A FRIEND

C9orf78

chromosome 9 open reading frame 78

Synonyms: HCA59 HSPC220 bA409K20.3
Species: Human C9orf78(51759)
UniProtKB ID: Q9NZ63, B3KPX8, Q8WVU6, Q9NT39
Gene ID:
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074251 MISSION® esiRNA esiRNA human C9orf78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016482 Rosetta Predictions human pricing
NM_016520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092137 predicted 693
2 SASI_Hs01_00092138 predicted 702
3 SASI_Hs01_00092139 predicted 439
4 SASI_Hs01_00092140 predicted 405
5 SASI_Hs01_00092141 predicted 450
6 SASI_Hs01_00092142 predicted 475
7 SASI_Hs01_00092143 predicted 504
8 SASI_Hs01_00092144 predicted 388
9 SASI_Hs01_00092145 predicted 710
10 SASI_Hs01_00092146 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074904 predicted 700
2 SASI_Hs01_00074907 predicted 285
3 SASI_Hs01_00074908 predicted 766
4 SASI_Hs01_00074911 predicted 763
5 SASI_Hs02_00349613 predicted 242
6 SASI_Hs01_00074913 predicted 290
7 SASI_Hs02_00349614 predicted 709
8 SASI_Hs02_00349615 predicted 219
9 SASI_Hs01_00074905 predicted 707
10 SASI_Hs01_00074906 predicted 446
11 SASI_Hs01_00074909 predicted 362
12 SASI_Hs01_00074910 predicted 734
13 SASI_Hs01_00074912 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016482
C9orf78 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 78
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000167643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-400s1c1
Sequence:CCGGGCAGACATGATGAAGTACATTCTCGAGAATGTACTTCATCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-497s1c1
Sequence:CCGGGTCTTTATGAACTTCCAGAAACTCGAGTTTCTGGAAGTTCATAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-478s1c1
Sequence:CCGGCCAAAGAATGCAGAGGACTGTCTCGAGACAGTCCTCTGCATTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016482
C9orf78 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 78
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000167643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-400s1c1
Sequence:CCGGGCAGACATGATGAAGTACATTCTCGAGAATGTACTTCATCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-497s1c1
Sequence:CCGGGTCTTTATGAACTTCCAGAAACTCGAGTTTCTGGAAGTTCATAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-478s1c1
Sequence:CCGGCCAAAGAATGCAGAGGACTGTCTCGAGACAGTCCTCTGCATTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016482
C9orf78 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 78
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000167643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-400s1c1
Sequence:CCGGGCAGACATGATGAAGTACATTCTCGAGAATGTACTTCATCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-497s1c1
Sequence:CCGGGTCTTTATGAACTTCCAGAAACTCGAGTTTCTGGAAGTTCATAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016482.2-478s1c1
Sequence:CCGGCCAAAGAATGCAGAGGACTGTCTCGAGACAGTCCTCTGCATTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016520
VALIDATED
C9orf78 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 78
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016520.2-716s21c1
Sequence:CCGGCCAACATGGCTGTGAATTATGCTCGAGCATAATTCACAGCCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-966s21c1
Sequence:CCGGATCGCCTTCCTCTCCCTATATCTCGAGATATAGGGAGAGGAAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-601s21c1
Sequence:CCGGGACCTGGGCATCGATGCTAAACTCGAGTTTAGCATCGATGCCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-141s21c1
Sequence:CCGGCTCAGAGGAGGTTCGATTAAACTCGAGTTTAATCGAACCTCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-888s21c1
Sequence:CCGGGGCAACTGATGACTATCATTACTCGAGTAATGATAGTCATCAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016520
VALIDATED
C9orf78 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 78
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016520.2-716s21c1
Sequence:CCGGCCAACATGGCTGTGAATTATGCTCGAGCATAATTCACAGCCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-966s21c1
Sequence:CCGGATCGCCTTCCTCTCCCTATATCTCGAGATATAGGGAGAGGAAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-601s21c1
Sequence:CCGGGACCTGGGCATCGATGCTAAACTCGAGTTTAGCATCGATGCCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-141s21c1
Sequence:CCGGCTCAGAGGAGGTTCGATTAAACTCGAGTTTAATCGAACCTCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-888s21c1
Sequence:CCGGGGCAACTGATGACTATCATTACTCGAGTAATGATAGTCATCAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016520
VALIDATED
C9orf78 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 78
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016520.2-716s21c1
Sequence:CCGGCCAACATGGCTGTGAATTATGCTCGAGCATAATTCACAGCCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-966s21c1
Sequence:CCGGATCGCCTTCCTCTCCCTATATCTCGAGATATAGGGAGAGGAAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-601s21c1
Sequence:CCGGGACCTGGGCATCGATGCTAAACTCGAGTTTAGCATCGATGCCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-141s21c1
Sequence:CCGGCTCAGAGGAGGTTCGATTAAACTCGAGTTTAATCGAACCTCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016520.2-888s21c1
Sequence:CCGGGGCAACTGATGACTATCATTACTCGAGTAATGATAGTCATCAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks