EMAIL THIS PAGE TO A FRIEND

C9orf84

chromosome 9 open reading frame 84

61 Gene Product Result for
Species: Human C9orf84(158401)
UniProtKB ID: Q5VXU9, A2A2V3, Q2M1H8, Q96M73
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA032108 Anti-C9orf84 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060621 MISSION® esiRNA esiRNA human C9orf84 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080551 Rosetta Predictions human pricing
NM_173521 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315890 predicted 1862
2 SASI_Hs02_00315891 predicted 2103
3 SASI_Hs02_00315892 predicted 3035
4 SASI_Hs02_00315893 predicted 3793
5 SASI_Hs02_00315894 predicted 3097
6 SASI_Hs02_00315895 predicted 2090
7 SASI_Hs02_00315896 predicted 2502
8 SASI_Hs02_00315897 predicted 914
9 SASI_Hs02_00315898 predicted 887
10 SASI_Hs02_00315899 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109492 predicted 1870
2 SASI_Hs01_00109494 predicted 2112
3 SASI_Hs01_00109495 predicted 3049
4 SASI_Hs02_00368301 predicted 3799
5 SASI_Hs02_00368302 predicted 3101
6 SASI_Hs01_00109497 predicted 2095
7 SASI_Hs02_00368303 predicted 2513
8 SASI_Hs01_00109499 predicted 899
9 SASI_Hs01_00109500 predicted 723
10 SASI_Hs02_00368304 predicted 3222
11 SASI_Hs01_00109493 predicted 646
12 SASI_Hs01_00109496 predicted 226
13 SASI_Hs01_00109498 predicted 1136
14 SASI_Hs01_00109501 predicted 4583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173521
C9orf84 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 84
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173521.3-3769s21c1
Sequence:CCGGTCAAGGAGACCGGCTTATAACCTCGAGGTTATAAGCCGGTCTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173521.3-4517s21c1
Sequence:CCGGGCTAATCCACTAGCGCAATTACTCGAGTAATTGCGCTAGTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173521.3-2166s21c1
Sequence:CCGGGGACACAGCATTGGGATATTTCTCGAGAAATATCCCAATGCTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1626s1c1
Sequence:CCGGCCAGAATTTATGACTTTGGATCTCGAGATCCAAAGTCATAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1330s1c1
Sequence:CCGGGCCTTGTGATTAATCTGGAAACTCGAGTTTCCAGATTAATCACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1074s1c1
Sequence:CCGGCCTCTATTCCTAACATGCCAACTCGAGTTGGCATGTTAGGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1473s1c1
Sequence:CCGGCCTACGAAAGTGCTTCAATTACTCGAGTAATTGAAGCACTTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173521
C9orf84 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 84
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173521.3-3769s21c1
Sequence:CCGGTCAAGGAGACCGGCTTATAACCTCGAGGTTATAAGCCGGTCTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173521.3-4517s21c1
Sequence:CCGGGCTAATCCACTAGCGCAATTACTCGAGTAATTGCGCTAGTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173521.3-2166s21c1
Sequence:CCGGGGACACAGCATTGGGATATTTCTCGAGAAATATCCCAATGCTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1626s1c1
Sequence:CCGGCCAGAATTTATGACTTTGGATCTCGAGATCCAAAGTCATAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1330s1c1
Sequence:CCGGGCCTTGTGATTAATCTGGAAACTCGAGTTTCCAGATTAATCACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1074s1c1
Sequence:CCGGCCTCTATTCCTAACATGCCAACTCGAGTTGGCATGTTAGGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1473s1c1
Sequence:CCGGCCTACGAAAGTGCTTCAATTACTCGAGTAATTGAAGCACTTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173521
C9orf84 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 84
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173521.3-3769s21c1
Sequence:CCGGTCAAGGAGACCGGCTTATAACCTCGAGGTTATAAGCCGGTCTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173521.3-4517s21c1
Sequence:CCGGGCTAATCCACTAGCGCAATTACTCGAGTAATTGCGCTAGTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173521.3-2166s21c1
Sequence:CCGGGGACACAGCATTGGGATATTTCTCGAGAAATATCCCAATGCTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1626s1c1
Sequence:CCGGCCAGAATTTATGACTTTGGATCTCGAGATCCAAAGTCATAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1330s1c1
Sequence:CCGGGCCTTGTGATTAATCTGGAAACTCGAGTTTCCAGATTAATCACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1074s1c1
Sequence:CCGGCCTCTATTCCTAACATGCCAACTCGAGTTGGCATGTTAGGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173521.1-1473s1c1
Sequence:CCGGCCTACGAAAGTGCTTCAATTACTCGAGTAATTGAAGCACTTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks