EMAIL THIS PAGE TO A FRIEND

C9orf85

chromosome 9 open reading frame 85

42 Gene Product Result for
Species: Human C9orf85(138241)
UniProtKB ID: Q96MD7, Q5W0N1, Q5W0N3, Q6PJW9, Q86U95
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198394 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182505 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099321 MISSION® esiRNA esiRNA human C9orf85 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182505 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215407 predicted 239
2 SASI_Hs01_00215408 predicted 453
3 SASI_Hs02_00370563 predicted 374
4 SASI_Hs01_00215409 predicted 484
5 SASI_Hs02_00370564 predicted 278
6 SASI_Hs01_00215411 predicted 355
7 SASI_Hs02_00370565 predicted 268
8 SASI_Hs01_00215413 predicted 360
9 SASI_Hs01_00215415 predicted 354
10 SASI_Hs01_00215416 predicted 268
11 SASI_Hs01_00215410 predicted 452
12 SASI_Hs01_00215412 predicted 488
13 SASI_Hs01_00215414 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198394
VALIDATED
C9orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 85
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-634s1c1
Sequence:CCGGCGCCTGTAATCCCAACACTTTCTCGAGAAAGTGTTGGGATTACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198394.1-266s1c1
Sequence:CCGGCTCAGAAGCACCAGAATACGTCTCGAGACGTATTCTGGTGCTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-268s1c1
Sequence:CCGGCAGAAGCACCAGAATACGTTTCTCGAGAAACGTATTCTGGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-277s1c1
Sequence:CCGGCAGAATACGTTTAGCTTCAAACTCGAGTTTGAAGCTAAACGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-431s1c1
Sequence:CCGGGACATTGTTATTCCGTTGAATCTCGAGATTCAACGGAATAACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-443s1c1
Sequence:CCGGCCGTTGAATAAAGAAACAGAACTCGAGTTCTGTTTCTTTATTCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-387s1c1
Sequence:CCGGGTGCCTGTGAACTTGAAGTTTCTCGAGAAACTTCAAGTTCACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-273s1c1
Sequence:CCGGGCACCAGAATACGTTTAGCTTCTCGAGAAGCTAAACGTATTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198394.1-270s1c1
Sequence:CCGGGAAGCACCAGAATACGTTTAGCTCGAGCTAAACGTATTCTGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198394
VALIDATED
C9orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 85
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-634s1c1
Sequence:CCGGCGCCTGTAATCCCAACACTTTCTCGAGAAAGTGTTGGGATTACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198394.1-266s1c1
Sequence:CCGGCTCAGAAGCACCAGAATACGTCTCGAGACGTATTCTGGTGCTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-268s1c1
Sequence:CCGGCAGAAGCACCAGAATACGTTTCTCGAGAAACGTATTCTGGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-277s1c1
Sequence:CCGGCAGAATACGTTTAGCTTCAAACTCGAGTTTGAAGCTAAACGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-431s1c1
Sequence:CCGGGACATTGTTATTCCGTTGAATCTCGAGATTCAACGGAATAACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-443s1c1
Sequence:CCGGCCGTTGAATAAAGAAACAGAACTCGAGTTCTGTTTCTTTATTCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-387s1c1
Sequence:CCGGGTGCCTGTGAACTTGAAGTTTCTCGAGAAACTTCAAGTTCACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-273s1c1
Sequence:CCGGGCACCAGAATACGTTTAGCTTCTCGAGAAGCTAAACGTATTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198394.1-270s1c1
Sequence:CCGGGAAGCACCAGAATACGTTTAGCTCGAGCTAAACGTATTCTGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198394
VALIDATED
C9orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 85
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-634s1c1
Sequence:CCGGCGCCTGTAATCCCAACACTTTCTCGAGAAAGTGTTGGGATTACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198394.1-266s1c1
Sequence:CCGGCTCAGAAGCACCAGAATACGTCTCGAGACGTATTCTGGTGCTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-268s1c1
Sequence:CCGGCAGAAGCACCAGAATACGTTTCTCGAGAAACGTATTCTGGTGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-277s1c1
Sequence:CCGGCAGAATACGTTTAGCTTCAAACTCGAGTTTGAAGCTAAACGTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-431s1c1
Sequence:CCGGGACATTGTTATTCCGTTGAATCTCGAGATTCAACGGAATAACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-443s1c1
Sequence:CCGGCCGTTGAATAAAGAAACAGAACTCGAGTTCTGTTTCTTTATTCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198394.1-387s1c1
Sequence:CCGGGTGCCTGTGAACTTGAAGTTTCTCGAGAAACTTCAAGTTCACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198394.1-273s1c1
Sequence:CCGGGCACCAGAATACGTTTAGCTTCTCGAGAAGCTAAACGTATTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198394.1-270s1c1
Sequence:CCGGGAAGCACCAGAATACGTTTAGCTCGAGCTAAACGTATTCTGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182505
VALIDATED
C9orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 85
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-675s21c1
Sequence:CCGGCACAGGAGGAGACCATCAAATCTCGAGATTTGATGGTCTCCTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182505.3-1085s21c1
Sequence:CCGGTGAAATCCTAATGAGGAAATCCTCGAGGATTTCCTCATTAGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-631s21c1
Sequence:CCGGGAAGAAAGTGATGATGATTTACTCGAGTAAATCATCATCACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-461s21c1
Sequence:CCGGTGAAGGATTCTTATCACATAACTCGAGTTATGTGATAAGAATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-269s21c1
Sequence:CCGGAGAAGCACCAGAATACGTTTACTCGAGTAAACGTATTCTGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-378s21c1
Sequence:CCGGAGTTCTTGAGTGGCGTGTAAACTCGAGTTTACACGCCACTCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-355s21c1
Sequence:CCGGGGAGTATGTCAGCGCTGTAAACTCGAGTTTACAGCGCTGACATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-403s21c1
Sequence:CCGGAGCAAATACAAACCATTATCACTCGAGTGATAATGGTTTGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182505
VALIDATED
C9orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 85
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-675s21c1
Sequence:CCGGCACAGGAGGAGACCATCAAATCTCGAGATTTGATGGTCTCCTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182505.3-1085s21c1
Sequence:CCGGTGAAATCCTAATGAGGAAATCCTCGAGGATTTCCTCATTAGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-631s21c1
Sequence:CCGGGAAGAAAGTGATGATGATTTACTCGAGTAAATCATCATCACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-461s21c1
Sequence:CCGGTGAAGGATTCTTATCACATAACTCGAGTTATGTGATAAGAATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-269s21c1
Sequence:CCGGAGAAGCACCAGAATACGTTTACTCGAGTAAACGTATTCTGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-378s21c1
Sequence:CCGGAGTTCTTGAGTGGCGTGTAAACTCGAGTTTACACGCCACTCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-355s21c1
Sequence:CCGGGGAGTATGTCAGCGCTGTAAACTCGAGTTTACAGCGCTGACATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-403s21c1
Sequence:CCGGAGCAAATACAAACCATTATCACTCGAGTGATAATGGTTTGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182505
VALIDATED
C9orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 85
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-675s21c1
Sequence:CCGGCACAGGAGGAGACCATCAAATCTCGAGATTTGATGGTCTCCTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182505.3-1085s21c1
Sequence:CCGGTGAAATCCTAATGAGGAAATCCTCGAGGATTTCCTCATTAGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-631s21c1
Sequence:CCGGGAAGAAAGTGATGATGATTTACTCGAGTAAATCATCATCACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-461s21c1
Sequence:CCGGTGAAGGATTCTTATCACATAACTCGAGTTATGTGATAAGAATCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-269s21c1
Sequence:CCGGAGAAGCACCAGAATACGTTTACTCGAGTAAACGTATTCTGGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-378s21c1
Sequence:CCGGAGTTCTTGAGTGGCGTGTAAACTCGAGTTTACACGCCACTCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182505.3-355s21c1
Sequence:CCGGGGAGTATGTCAGCGCTGTAAACTCGAGTTTACAGCGCTGACATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182505.3-403s21c1
Sequence:CCGGAGCAAATACAAACCATTATCACTCGAGTGATAATGGTTTGTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks