EMAIL THIS PAGE TO A FRIEND

C9orf89

chromosome 9 open reading frame 89

33 Gene Product Result for
Synonyms: BinCARD bA370F5.1
Species: Human C9orf89(84270)
UniProtKB ID: Q96LW7, Q5BJH8, Q9BSY2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032310 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084649 predicted 282
2 SASI_Hs02_00359657 predicted 403
3 SASI_Hs01_00084650 predicted 587
4 SASI_Hs01_00084651 predicted 420
5 SASI_Hs01_00084652 predicted 639
6 SASI_Hs01_00084653 predicted 542
7 SASI_Hs01_00084654 predicted 210
8 SASI_Hs01_00084656 predicted 294
9 SASI_Hs01_00084657 predicted 486
10 SASI_Hs01_00084658 predicted 487
11 SASI_Hs01_00084655 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032310
VALIDATED
C9orf89 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 89
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-648s21c1
Sequence:CCGGTCGGTTTCTCGCCTGTCATCACTCGAGTGATGACAGGCGAGAAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-272s21c1
Sequence:CCGGATCCTCCAGCTGAACCGTTACCTCGAGGTAACGGTTCAGCTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-752s21c1
Sequence:CCGGCACCTGCCACTCAACCAAAGACTCGAGTCTTTGGTTGAGTGGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032310.3-415s21c1
Sequence:CCGGGTTCTACCGAGCCCTGTATATCTCGAGATATACAGGGCTCGGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-306s21c1
Sequence:CCGGTTACCAACAAGGAGGCGGAAACTCGAGTTTCCGCCTCCTTGTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032310
VALIDATED
C9orf89 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 89
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-648s21c1
Sequence:CCGGTCGGTTTCTCGCCTGTCATCACTCGAGTGATGACAGGCGAGAAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-272s21c1
Sequence:CCGGATCCTCCAGCTGAACCGTTACCTCGAGGTAACGGTTCAGCTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-752s21c1
Sequence:CCGGCACCTGCCACTCAACCAAAGACTCGAGTCTTTGGTTGAGTGGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032310.3-415s21c1
Sequence:CCGGGTTCTACCGAGCCCTGTATATCTCGAGATATACAGGGCTCGGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-306s21c1
Sequence:CCGGTTACCAACAAGGAGGCGGAAACTCGAGTTTCCGCCTCCTTGTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032310
VALIDATED
C9orf89 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 89
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-648s21c1
Sequence:CCGGTCGGTTTCTCGCCTGTCATCACTCGAGTGATGACAGGCGAGAAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-272s21c1
Sequence:CCGGATCCTCCAGCTGAACCGTTACCTCGAGGTAACGGTTCAGCTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-752s21c1
Sequence:CCGGCACCTGCCACTCAACCAAAGACTCGAGTCTTTGGTTGAGTGGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032310.3-415s21c1
Sequence:CCGGGTTCTACCGAGCCCTGTATATCTCGAGATATACAGGGCTCGGTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_032310.3-306s21c1
Sequence:CCGGTTACCAACAAGGAGGCGGAAACTCGAGTTTCCGCCTCCTTGTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks