EMAIL THIS PAGE TO A FRIEND

C9orf91

chromosome 9 open reading frame 91

77 Gene Product Result for
Synonyms: RP11-402G3.2
Species: Human C9orf91(203197)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153045 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141904 predicted 679
2 SASI_Hs01_00141905 predicted 1080
3 SASI_Hs01_00141906 predicted 645
4 SASI_Hs01_00141907 predicted 790
5 SASI_Hs01_00141908 predicted 515
6 SASI_Hs02_00366998 predicted 562
7 SASI_Hs01_00141910 predicted 453
8 SASI_Hs01_00141911 predicted 568
9 SASI_Hs01_00141912 predicted 482
10 SASI_Hs01_00141913 predicted 509
11 SASI_Hs01_00141909 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153045
VALIDATED
C9orf91 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 91
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-856s1c1
Sequence:CCGGGAGTGTGATTCAGCTTTGGTTCTCGAGAACCAAAGCTGAATCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-2210s1c1
Sequence:CCGGCCAAGACCAAACGCATCTAAACTCGAGTTTAGATGCGTTTGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-422s1c1
Sequence:CCGGCGGATTGACAATACCTGTGCACTCGAGTGCACAGGTATTGTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-1059s1c1
Sequence:CCGGGCAATTCTTGTCCTAACGAGACTCGAGTCTCGTTAGGACAAGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-637s1c1
Sequence:CCGGCTACTCTACCAGTCAGATGTTCTCGAGAACATCTGACTGGTAGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-993s21c1
Sequence:CCGGGCAATTCTTGTCCTAACGAGACTCGAGTCTCGTTAGGACAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-790s21c1
Sequence:CCGGGAGTGTGATTCAGCTTTGGTTCTCGAGAACCAAAGCTGAATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153045.3-2144s21c1
Sequence:CCGGCCAAGACCAAACGCATCTAAACTCGAGTTTAGATGCGTTTGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-356s21c1
Sequence:CCGGCGGATTGACAATACCTGTGCACTCGAGTGCACAGGTATTGTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-571s21c1
Sequence:CCGGCTACTCTACCAGTCAGATGTTCTCGAGAACATCTGACTGGTAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153045
VALIDATED
C9orf91 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 91
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-856s1c1
Sequence:CCGGGAGTGTGATTCAGCTTTGGTTCTCGAGAACCAAAGCTGAATCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-2210s1c1
Sequence:CCGGCCAAGACCAAACGCATCTAAACTCGAGTTTAGATGCGTTTGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-422s1c1
Sequence:CCGGCGGATTGACAATACCTGTGCACTCGAGTGCACAGGTATTGTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-1059s1c1
Sequence:CCGGGCAATTCTTGTCCTAACGAGACTCGAGTCTCGTTAGGACAAGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-637s1c1
Sequence:CCGGCTACTCTACCAGTCAGATGTTCTCGAGAACATCTGACTGGTAGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-993s21c1
Sequence:CCGGGCAATTCTTGTCCTAACGAGACTCGAGTCTCGTTAGGACAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-790s21c1
Sequence:CCGGGAGTGTGATTCAGCTTTGGTTCTCGAGAACCAAAGCTGAATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153045.3-2144s21c1
Sequence:CCGGCCAAGACCAAACGCATCTAAACTCGAGTTTAGATGCGTTTGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-356s21c1
Sequence:CCGGCGGATTGACAATACCTGTGCACTCGAGTGCACAGGTATTGTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-571s21c1
Sequence:CCGGCTACTCTACCAGTCAGATGTTCTCGAGAACATCTGACTGGTAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153045
VALIDATED
C9orf91 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 91
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-856s1c1
Sequence:CCGGGAGTGTGATTCAGCTTTGGTTCTCGAGAACCAAAGCTGAATCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-2210s1c1
Sequence:CCGGCCAAGACCAAACGCATCTAAACTCGAGTTTAGATGCGTTTGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-422s1c1
Sequence:CCGGCGGATTGACAATACCTGTGCACTCGAGTGCACAGGTATTGTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-1059s1c1
Sequence:CCGGGCAATTCTTGTCCTAACGAGACTCGAGTCTCGTTAGGACAAGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153045.2-637s1c1
Sequence:CCGGCTACTCTACCAGTCAGATGTTCTCGAGAACATCTGACTGGTAGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-993s21c1
Sequence:CCGGGCAATTCTTGTCCTAACGAGACTCGAGTCTCGTTAGGACAAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-790s21c1
Sequence:CCGGGAGTGTGATTCAGCTTTGGTTCTCGAGAACCAAAGCTGAATCACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153045.3-2144s21c1
Sequence:CCGGCCAAGACCAAACGCATCTAAACTCGAGTTTAGATGCGTTTGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-356s21c1
Sequence:CCGGCGGATTGACAATACCTGTGCACTCGAGTGCACAGGTATTGTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153045.3-571s21c1
Sequence:CCGGCTACTCTACCAGTCAGATGTTCTCGAGAACATCTGACTGGTAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks