EMAIL THIS PAGE TO A FRIEND

C9orf96

chromosome 9 open reading frame 96

41 Gene Product Result for
Synonyms: SgK071 Sk521
Species: Human C9orf96(169436)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153710 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225855 predicted 2160
2 SASI_Hs01_00225856 predicted 529
3 SASI_Hs01_00225857 predicted 872
4 SASI_Hs01_00225858 predicted 2107
5 SASI_Hs01_00225859 predicted 207
6 SASI_Hs02_00367437 predicted 604
7 SASI_Hs01_00225860 predicted 606
8 SASI_Hs01_00225862 predicted 601
9 SASI_Hs01_00225863 predicted 209
10 SASI_Hs01_00225864 predicted 875
11 SASI_Hs01_00225861 predicted 2163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376921
C9orf96 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 96
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376921.1-2376s1c1
Sequence:CCGGCCTTCCAGGAACTGGTTTCTTCTCGAGAAGAAACCAGTTCCTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-266s1c1
Sequence:CCGGGCATGTGATAAAGCAGGTGGACTCGAGTCCACCTGCTTTATCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-495s1c1
Sequence:CCGGGACTCTGAGTGGATGCAGAATCTCGAGATTCTGCATCCACTCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-647s1c1
Sequence:CCGGGCTAATGACAGACAAAGCCAACTCGAGTTGGCTTTGTCTGTCATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-953s1c1
Sequence:CCGGCTCGGATCGAATAACGATAAACTCGAGTTTATCGTTATTCGATCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376921
C9orf96 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 96
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376921.1-2376s1c1
Sequence:CCGGCCTTCCAGGAACTGGTTTCTTCTCGAGAAGAAACCAGTTCCTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-266s1c1
Sequence:CCGGGCATGTGATAAAGCAGGTGGACTCGAGTCCACCTGCTTTATCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-495s1c1
Sequence:CCGGGACTCTGAGTGGATGCAGAATCTCGAGATTCTGCATCCACTCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-647s1c1
Sequence:CCGGGCTAATGACAGACAAAGCCAACTCGAGTTGGCTTTGTCTGTCATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-953s1c1
Sequence:CCGGCTCGGATCGAATAACGATAAACTCGAGTTTATCGTTATTCGATCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376921
C9orf96 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 96
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376921.1-2376s1c1
Sequence:CCGGCCTTCCAGGAACTGGTTTCTTCTCGAGAAGAAACCAGTTCCTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-266s1c1
Sequence:CCGGGCATGTGATAAAGCAGGTGGACTCGAGTCCACCTGCTTTATCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-495s1c1
Sequence:CCGGGACTCTGAGTGGATGCAGAATCTCGAGATTCTGCATCCACTCAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-647s1c1
Sequence:CCGGGCTAATGACAGACAAAGCCAACTCGAGTTGGCTTTGTCTGTCATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376921.1-953s1c1
Sequence:CCGGCTCGGATCGAATAACGATAAACTCGAGTTTATCGTTATTCGATCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153710
VALIDATED
C9orf96 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 96
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153710.3-1007s1c1
Sequence:CCGGCCTGCGTCCATCACCGACATGCTCGAGCATGTCGGTGATGGACGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153710.3-2560s1c1
Sequence:CCGGCACTCCTCTTAGGTGACTAATCTCGAGATTAGTCACCTAAGAGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153710.3-2605s1c1
Sequence:CCGGCCTTAATCATTTCTGGCAAGACTCGAGTCTTGCCAGAAATGATTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153710.3-132s1c1
Sequence:CCGGCCATGGAGAAGTACCAGGTTTCTCGAGAAACCTGGTACTTCTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153710.3-1351s1c1
Sequence:CCGGGCCACTTCTTGTCATGGTCTACTCGAGTAGACCATGACAAGAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153710
VALIDATED
C9orf96 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 96
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153710.3-1007s1c1
Sequence:CCGGCCTGCGTCCATCACCGACATGCTCGAGCATGTCGGTGATGGACGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153710.3-2560s1c1
Sequence:CCGGCACTCCTCTTAGGTGACTAATCTCGAGATTAGTCACCTAAGAGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153710.3-2605s1c1
Sequence:CCGGCCTTAATCATTTCTGGCAAGACTCGAGTCTTGCCAGAAATGATTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153710.3-132s1c1
Sequence:CCGGCCATGGAGAAGTACCAGGTTTCTCGAGAAACCTGGTACTTCTCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153710.3-1351s1c1
Sequence:CCGGGCCACTTCTTGTCATGGTCTACTCGAGTAGACCATGACAAGAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153710
VALIDATED
C9orf96 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 96
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153710.3-1007s1c1
Sequence:CCGGCCTGCGTCCATCACCGACATGCTCGAGCATGTCGGTGATGGACGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153710.3-2560s1c1
Sequence:CCGGCACTCCTCTTAGGTGACTAATCTCGAGATTAGTCACCTAAGAGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153710.3-2605s1c1
Sequence:CCGGCCTTAATCATTTCTGGCAAGACTCGAGTCTTGCCAGAAATGATTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153710.3-132s1c1
Sequence:CCGGCCATGGAGAAGTACCAGGTTTCTCGAGAAACCTGGTACTTCTCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153710.3-1351s1c1
Sequence:CCGGGCCACTTCTTGTCATGGTCTACTCGAGTAGACCATGACAAGAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)