EMAIL THIS PAGE TO A FRIEND

C9orf9

chromosome 9 open reading frame 9

34 Gene Product Result for
UniProtKB ID: Q96E40, Q9UGQ0
Gene ID:
chicken(772069) chromosome 17 open reading frame, human C9orf9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098631 MISSION® esiRNA esiRNA human C9orf9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018956 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076169 predicted 337
2 SASI_Hs01_00076170 predicted 343
3 SASI_Hs01_00076171 predicted 495
4 SASI_Hs01_00076173 predicted 239
5 SASI_Hs01_00076174 predicted 456
6 SASI_Hs01_00076175 predicted 389
7 SASI_Hs01_00076176 predicted 298
8 SASI_Hs01_00076177 predicted 474
9 SASI_Hs02_00352428 predicted 450
10 SASI_Hs02_00352429 predicted 362
11 SASI_Hs01_00076172 predicted 272
12 SASI_Hs01_00076178 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018956
VALIDATED
C9orf9 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-460s21c1
Sequence:CCGGTTAGCCAAAGCAACGACTTAACTCGAGTTAAGTCGTTGCTTTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-177s21c1
Sequence:CCGGAGCATCGAGCAGAAGTACAAGCTCGAGCTTGTACTTCTGCTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-427s21c1
Sequence:CCGGCCAACAACCTCCTGGAGAAATCTCGAGATTTCTCCAGGAGGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-298s21c1
Sequence:CCGGAGAGCTACATGGAACACTACTCTCGAGAGTAGTGTTCCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018956.3-363s21c1
Sequence:CCGGATCTGTTCAGAGCTGAATAAGCTCGAGCTTATTCAGCTCTGAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018956.3-182s1c1
Sequence:CCGGCGAGCAGAAGTACAAGCTCTTCTCGAGAAGAGCTTGTACTTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018956.3-297s1c1
Sequence:CCGGCAGAGCTACATGGAACACTACCTCGAGGTAGTGTTCCATGTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018956
VALIDATED
C9orf9 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-460s21c1
Sequence:CCGGTTAGCCAAAGCAACGACTTAACTCGAGTTAAGTCGTTGCTTTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-177s21c1
Sequence:CCGGAGCATCGAGCAGAAGTACAAGCTCGAGCTTGTACTTCTGCTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-427s21c1
Sequence:CCGGCCAACAACCTCCTGGAGAAATCTCGAGATTTCTCCAGGAGGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-298s21c1
Sequence:CCGGAGAGCTACATGGAACACTACTCTCGAGAGTAGTGTTCCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018956.3-363s21c1
Sequence:CCGGATCTGTTCAGAGCTGAATAAGCTCGAGCTTATTCAGCTCTGAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018956.3-182s1c1
Sequence:CCGGCGAGCAGAAGTACAAGCTCTTCTCGAGAAGAGCTTGTACTTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018956.3-297s1c1
Sequence:CCGGCAGAGCTACATGGAACACTACCTCGAGGTAGTGTTCCATGTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018956
VALIDATED
C9orf9 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-460s21c1
Sequence:CCGGTTAGCCAAAGCAACGACTTAACTCGAGTTAAGTCGTTGCTTTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-177s21c1
Sequence:CCGGAGCATCGAGCAGAAGTACAAGCTCGAGCTTGTACTTCTGCTCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-427s21c1
Sequence:CCGGCCAACAACCTCCTGGAGAAATCTCGAGATTTCTCCAGGAGGTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018956.3-298s21c1
Sequence:CCGGAGAGCTACATGGAACACTACTCTCGAGAGTAGTGTTCCATGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018956.3-363s21c1
Sequence:CCGGATCTGTTCAGAGCTGAATAAGCTCGAGCTTATTCAGCTCTGAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018956.3-182s1c1
Sequence:CCGGCGAGCAGAAGTACAAGCTCTTCTCGAGAAGAGCTTGTACTTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018956.3-297s1c1
Sequence:CCGGCAGAGCTACATGGAACACTACCTCGAGGTAGTGTTCCATGTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks