EMAIL THIS PAGE TO A FRIEND

CA10

carbonic anhydrase X

129 Gene Product Result for
Synonyms: CA-RPX CARPX HUCEP-15
UniProtKB ID: Q9NS85, B2R7J0
Gene ID:
Human(56934) Summary: This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(100360015) carbonic anhydrase 10
domestic guinea pig(100712997) carbonic anhydrase X
chicken(417389) carbonic anhydrase X
cow(535917) carbonic anhydrase X
Horse(100056500) carbonic anhydrase X
dog(609477) carbonic anhydrase X
domestic cat(101086609) carbonic anhydrase X
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020178 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085811 MISSION® esiRNA esiRNA human CA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082533 Rosetta Predictions human pricing
NM_001082534 Rosetta Predictions human pricing
NM_020178 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316652 predicted 1714
2 SASI_Hs02_00316653 predicted 1638
3 SASI_Hs02_00316654 predicted 1852
4 SASI_Hs02_00316655 predicted 1622
5 SASI_Hs02_00316656 predicted 1639
6 SASI_Hs02_00316657 predicted 1763
7 SASI_Hs02_00316658 predicted 1871
8 SASI_Hs02_00316659 predicted 1935
9 SASI_Hs02_00316660 predicted 1594
10 SASI_Hs02_00316661 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316662 predicted 1277
2 SASI_Hs02_00316663 predicted 1199
3 SASI_Hs02_00316664 predicted 1414
4 SASI_Hs02_00316665 predicted 1187
5 SASI_Hs02_00316666 predicted 1206
6 SASI_Hs02_00316667 predicted 1334
7 SASI_Hs02_00316668 predicted 1435
8 SASI_Hs02_00316669 predicted 1501
9 SASI_Hs02_00316670 predicted 1159
10 SASI_Hs02_00316671 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108631 predicted 1580
2 SASI_Hs01_00108632 predicted 1508
3 SASI_Hs01_00108633 predicted 1721
4 SASI_Hs01_00108634 predicted 1499
5 SASI_Hs01_00108635 predicted 1515
6 SASI_Hs01_00108636 predicted 1641
7 SASI_Hs01_00108637 predicted 1751
8 SASI_Hs01_00108638 predicted 1807
9 SASI_Hs01_00108639 predicted 1475
10 SASI_Hs01_00108640 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020178
CA10 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase X
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-998s1c1
Sequence:CCGGCAAGGAGCACTTGGTCAACATCTCGAGATGTTGACCAAGTGCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1271s1c1
Sequence:CCGGCAGAGATACTATCACAAGAATCTCGAGATTCTTGTGATAGTATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1236s1c1
Sequence:CCGGGATTCATCAAACCCATTTCTTCTCGAGAAGAAATGGGTTTGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1616s1c1
Sequence:CCGGGAAGCTTCAGTATAGAGTAAACTCGAGTTTACTCTATACTGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1201s1c1
Sequence:CCGGGATTGGTGGTAGTTTCTATATCTCGAGATATAGAAACTACCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1562s1c1
Sequence:CCGGCACCAATATCAACTTCAGTTTCTCGAGAAACTGAAGTTGATATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-1421s1c1
Sequence:CCGGCATAATGAACAAACCTGTCTACTCGAGTAGACAGGTTTGTTCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-706s1c1
Sequence:CCGGCCAATTTCATCGTCTGCATATCTCGAGATATGCAGACGATGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-875s1c1
Sequence:CCGGCAACATAGAGACCAGTCACATCTCGAGATGTGACTGGTCTCTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-1168s1c1
Sequence:CCGGCGAATGTCACAGAAGCTGCAACTCGAGTTGCAGCTTCTGTGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-908s1c1
Sequence:CCGGCTTTCTGACACCTCTTCGCATCTCGAGATGCGAAGAGGTGTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020178
CA10 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase X
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-998s1c1
Sequence:CCGGCAAGGAGCACTTGGTCAACATCTCGAGATGTTGACCAAGTGCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1271s1c1
Sequence:CCGGCAGAGATACTATCACAAGAATCTCGAGATTCTTGTGATAGTATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1236s1c1
Sequence:CCGGGATTCATCAAACCCATTTCTTCTCGAGAAGAAATGGGTTTGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1616s1c1
Sequence:CCGGGAAGCTTCAGTATAGAGTAAACTCGAGTTTACTCTATACTGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1201s1c1
Sequence:CCGGGATTGGTGGTAGTTTCTATATCTCGAGATATAGAAACTACCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1562s1c1
Sequence:CCGGCACCAATATCAACTTCAGTTTCTCGAGAAACTGAAGTTGATATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-1421s1c1
Sequence:CCGGCATAATGAACAAACCTGTCTACTCGAGTAGACAGGTTTGTTCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-706s1c1
Sequence:CCGGCCAATTTCATCGTCTGCATATCTCGAGATATGCAGACGATGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-875s1c1
Sequence:CCGGCAACATAGAGACCAGTCACATCTCGAGATGTGACTGGTCTCTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-1168s1c1
Sequence:CCGGCGAATGTCACAGAAGCTGCAACTCGAGTTGCAGCTTCTGTGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-908s1c1
Sequence:CCGGCTTTCTGACACCTCTTCGCATCTCGAGATGCGAAGAGGTGTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020178
CA10 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase X
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-998s1c1
Sequence:CCGGCAAGGAGCACTTGGTCAACATCTCGAGATGTTGACCAAGTGCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1271s1c1
Sequence:CCGGCAGAGATACTATCACAAGAATCTCGAGATTCTTGTGATAGTATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1236s1c1
Sequence:CCGGGATTCATCAAACCCATTTCTTCTCGAGAAGAAATGGGTTTGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1616s1c1
Sequence:CCGGGAAGCTTCAGTATAGAGTAAACTCGAGTTTACTCTATACTGAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1201s1c1
Sequence:CCGGGATTGGTGGTAGTTTCTATATCTCGAGATATAGAAACTACCACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020178.2-1562s1c1
Sequence:CCGGCACCAATATCAACTTCAGTTTCTCGAGAAACTGAAGTTGATATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-1421s1c1
Sequence:CCGGCATAATGAACAAACCTGTCTACTCGAGTAGACAGGTTTGTTCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-706s1c1
Sequence:CCGGCCAATTTCATCGTCTGCATATCTCGAGATATGCAGACGATGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-875s1c1
Sequence:CCGGCAACATAGAGACCAGTCACATCTCGAGATGTGACTGGTCTCTATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-1168s1c1
Sequence:CCGGCGAATGTCACAGAAGCTGCAACTCGAGTTGCAGCTTCTGTGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020178.2-908s1c1
Sequence:CCGGCTTTCTGACACCTCTTCGCATCTCGAGATGCGAAGAGGTGTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks