EMAIL THIS PAGE TO A FRIEND

CA11

carbonic anhydrase XI

21 Gene Product Result for
Synonyms: CARPX1
UniProtKB ID: O75493, O60596, Q6FHI1, Q9UEC4
Gene ID:
Human(770) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]
domestic cat(101081097) carbonic anhydrase XI
cow(326334) carbonic anhydrase XI
dog(484400) carbonic anhydrase XI
domestic guinea pig(100730055) carbonic anhydrase XI
naked mole-rat(101719709) carbonic anhydrase XI
sheep(443426) carbonic anhydrase XI
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001217 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160801 MISSION® esiRNA esiRNA human CA11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001217 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034299 predicted 1319
2 SASI_Hs01_00034300 predicted 772
3 SASI_Hs01_00034301 predicted 1125
4 SASI_Hs01_00034302 predicted 1299
5 SASI_Hs01_00034303 predicted 1326
6 SASI_Hs01_00034304 predicted 1155
7 SASI_Hs01_00034305 predicted 1017
8 SASI_Hs01_00034306 predicted 1314
9 SASI_Hs01_00034307 predicted 1047
10 SASI_Hs02_00331370 predicted 1201
11 SASI_Hs01_00034308 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001217
CA11 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase XI
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-928s1c1
Sequence:CCGGCAACGTTGCCAGTACCTCTAACTCGAGTTAGAGGTACTGGCAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-989s1c1
Sequence:CCGGCGCATCTCCTACAAGAATGATCTCGAGATCATTCTTGTAGGAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-584s1c1
Sequence:CCGGGAGCTGAAGAGGGTTCTTTATCTCGAGATAAAGAACCCTCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-1141s1c1
Sequence:CCGGCAATATCACCTCCCTTCAGATCTCGAGATCTGAAGGGAGGTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-1186s1c1
Sequence:CCGGGAATCCTCCATCTCAGATCTTCTCGAGAAGATCTGAGATGGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-475s1c1
Sequence:CCGGCAAGGATAATCTCCAGGGAAACTCGAGTTTCCCTGGAGATTATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-856s1c1
Sequence:CCGGCCAGGAACTCTACGGGAATTTCTCGAGAAATTCCCGTAGAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-841s1c1
Sequence:CCGGGCTCATTCACTTCAACCAGGACTCGAGTCCTGGTTGAAGTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1125s21c1
Sequence:CCGGTCAACGTTGCCAGTACCTCTACTCGAGTAGAGGTACTGGCAACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1150s21c1
Sequence:CCGGATTCCTCAGTCGCCTCCTTAACTCGAGTTAAGGAGGCGACTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1255s21c1
Sequence:CCGGCTTCGGCTTCATCACCTATCACTCGAGTGATAGGTGATGAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001217
CA11 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase XI
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-928s1c1
Sequence:CCGGCAACGTTGCCAGTACCTCTAACTCGAGTTAGAGGTACTGGCAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-989s1c1
Sequence:CCGGCGCATCTCCTACAAGAATGATCTCGAGATCATTCTTGTAGGAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-584s1c1
Sequence:CCGGGAGCTGAAGAGGGTTCTTTATCTCGAGATAAAGAACCCTCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-1141s1c1
Sequence:CCGGCAATATCACCTCCCTTCAGATCTCGAGATCTGAAGGGAGGTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-1186s1c1
Sequence:CCGGGAATCCTCCATCTCAGATCTTCTCGAGAAGATCTGAGATGGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-475s1c1
Sequence:CCGGCAAGGATAATCTCCAGGGAAACTCGAGTTTCCCTGGAGATTATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-856s1c1
Sequence:CCGGCCAGGAACTCTACGGGAATTTCTCGAGAAATTCCCGTAGAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-841s1c1
Sequence:CCGGGCTCATTCACTTCAACCAGGACTCGAGTCCTGGTTGAAGTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1125s21c1
Sequence:CCGGTCAACGTTGCCAGTACCTCTACTCGAGTAGAGGTACTGGCAACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1150s21c1
Sequence:CCGGATTCCTCAGTCGCCTCCTTAACTCGAGTTAAGGAGGCGACTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1255s21c1
Sequence:CCGGCTTCGGCTTCATCACCTATCACTCGAGTGATAGGTGATGAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001217
CA11 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase XI
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-928s1c1
Sequence:CCGGCAACGTTGCCAGTACCTCTAACTCGAGTTAGAGGTACTGGCAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-989s1c1
Sequence:CCGGCGCATCTCCTACAAGAATGATCTCGAGATCATTCTTGTAGGAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-584s1c1
Sequence:CCGGGAGCTGAAGAGGGTTCTTTATCTCGAGATAAAGAACCCTCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-1141s1c1
Sequence:CCGGCAATATCACCTCCCTTCAGATCTCGAGATCTGAAGGGAGGTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-1186s1c1
Sequence:CCGGGAATCCTCCATCTCAGATCTTCTCGAGAAGATCTGAGATGGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-475s1c1
Sequence:CCGGCAAGGATAATCTCCAGGGAAACTCGAGTTTCCCTGGAGATTATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-856s1c1
Sequence:CCGGCCAGGAACTCTACGGGAATTTCTCGAGAAATTCCCGTAGAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001217.2-841s1c1
Sequence:CCGGGCTCATTCACTTCAACCAGGACTCGAGTCCTGGTTGAAGTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1125s21c1
Sequence:CCGGTCAACGTTGCCAGTACCTCTACTCGAGTAGAGGTACTGGCAACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1150s21c1
Sequence:CCGGATTCCTCAGTCGCCTCCTTAACTCGAGTTAAGGAGGCGACTGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001217.3-1255s21c1
Sequence:CCGGCTTCGGCTTCATCACCTATCACTCGAGTGATAGGTGATGAAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks