EMAIL THIS PAGE TO A FRIEND

CA12

carbonic anhydrase XII

77 Gene Product Result for
Synonyms: CAXII HsT18816
UniProtKB ID: O43570, Q53YE5, Q9BWG2
Gene ID:
Human(771) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. This gene product is a type I membrane protein that is highly expressed in normal tissues, such as kidney, colon and pancreas, and has been found to be overexpressed in 10% of clear cell renal carcinomas. Two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
sheep(101111288) carbonic anhydrase XII
Domestic Rabbit(100008777) carbonic anhydrase XII
naked mole-rat(101711828) carbonic anhydrase XII
domestic guinea pig(100727362) carbonic anhydrase XII
chicken(415370) carbonic anhydrase XII
cow(614323) carbonic anhydrase XII
Horse(100054028) carbonic anhydrase XII
domestic cat(101090522) carbonic anhydrase XII
dog(478333) carbonic anhydrase XII
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing
A6011 Acetazolamide ≥99%, powder human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1298 Human CA12 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206925 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071971 MISSION® esiRNA esiRNA human CA12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001218 Rosetta Predictions human pricing
NM_206925 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079160 predicted 271
2 SASI_Hs02_00331371 predicted 583
3 SASI_Hs02_00331372 predicted 423
4 SASI_Hs01_00079161 predicted 237
5 SASI_Hs01_00079162 predicted 745
6 SASI_Hs01_00079163 predicted 592
7 SASI_Hs01_00079164 predicted 1313
8 SASI_Hs01_00079165 predicted 386
9 SASI_Hs01_00079166 predicted 1444
10 SASI_Hs01_00079167 predicted 339
11 SASI_Hs01_00079168 predicted 721
12 SASI_Hs01_00079169 predicted 1487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230028 predicted 270
2 SASI_Hs02_00373627 predicted 581
3 SASI_Hs02_00373628 predicted 421
4 SASI_Hs01_00230029 predicted 232
5 SASI_Hs01_00230030 predicted 750
6 SASI_Hs01_00230031 predicted 593
7 SASI_Hs01_00230032 predicted 1278
8 SASI_Hs01_00230033 predicted 382
9 SASI_Hs01_00230034 predicted 1408
10 SASI_Hs01_00230035 predicted 331
11 SASI_Hs01_00230036 predicted 719
12 SASI_Hs01_00230037 predicted 1461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206925
VALIDATED
CA12 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase XII
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-239s21c1
Sequence:CCGGACGGTTCCAAGTGGACTTATTCTCGAGAATAAGTCCACTTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-390s21c1
Sequence:CCGGCTACAATCTGTCTGCCAACAACTCGAGTTGTTGGCAGACAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-994s21c1
Sequence:CCGGTTCGATGAGAGGCTGGTATACCTCGAGGTATACCAGCCTCTCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-1127s21c1
Sequence:CCGGGTGATAACAAGGGAGTCATTTCTCGAGAAATGACTCCCTTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-1981s1c1
Sequence:CCGGGCCATAATGTAAGGACAGAATCTCGAGATTCTGTCCTTACATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-1127s1c1
Sequence:CCGGGTGATAACAAGGGAGTCATTTCTCGAGAAATGACTCCCTTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-760s1c1
Sequence:CCGGGTCCCGGGATTCAACATTGAACTCGAGTTCAATGTTGAATCCCGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-597s1c1
Sequence:CCGGCCATTATAACTCAGACCTTTACTCGAGTAAAGGTCTGAGTTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206925.1-390s1c1
Sequence:CCGGCTACAATCTGTCTGCCAACAACTCGAGTTGTTGGCAGACAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206925
VALIDATED
CA12 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase XII
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-239s21c1
Sequence:CCGGACGGTTCCAAGTGGACTTATTCTCGAGAATAAGTCCACTTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-390s21c1
Sequence:CCGGCTACAATCTGTCTGCCAACAACTCGAGTTGTTGGCAGACAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-994s21c1
Sequence:CCGGTTCGATGAGAGGCTGGTATACCTCGAGGTATACCAGCCTCTCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-1127s21c1
Sequence:CCGGGTGATAACAAGGGAGTCATTTCTCGAGAAATGACTCCCTTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-1981s1c1
Sequence:CCGGGCCATAATGTAAGGACAGAATCTCGAGATTCTGTCCTTACATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-1127s1c1
Sequence:CCGGGTGATAACAAGGGAGTCATTTCTCGAGAAATGACTCCCTTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-760s1c1
Sequence:CCGGGTCCCGGGATTCAACATTGAACTCGAGTTCAATGTTGAATCCCGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-597s1c1
Sequence:CCGGCCATTATAACTCAGACCTTTACTCGAGTAAAGGTCTGAGTTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206925.1-390s1c1
Sequence:CCGGCTACAATCTGTCTGCCAACAACTCGAGTTGTTGGCAGACAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206925
VALIDATED
CA12 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase XII
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-239s21c1
Sequence:CCGGACGGTTCCAAGTGGACTTATTCTCGAGAATAAGTCCACTTGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-390s21c1
Sequence:CCGGCTACAATCTGTCTGCCAACAACTCGAGTTGTTGGCAGACAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-994s21c1
Sequence:CCGGTTCGATGAGAGGCTGGTATACCTCGAGGTATACCAGCCTCTCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206925.1-1127s21c1
Sequence:CCGGGTGATAACAAGGGAGTCATTTCTCGAGAAATGACTCCCTTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-1981s1c1
Sequence:CCGGGCCATAATGTAAGGACAGAATCTCGAGATTCTGTCCTTACATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-1127s1c1
Sequence:CCGGGTGATAACAAGGGAGTCATTTCTCGAGAAATGACTCCCTTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-760s1c1
Sequence:CCGGGTCCCGGGATTCAACATTGAACTCGAGTTCAATGTTGAATCCCGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_206925.1-597s1c1
Sequence:CCGGCCATTATAACTCAGACCTTTACTCGAGTAAAGGTCTGAGTTATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206925.1-390s1c1
Sequence:CCGGCTACAATCTGTCTGCCAACAACTCGAGTTGTTGGCAGACAGATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks