EMAIL THIS PAGE TO A FRIEND

CA13

carbonic anhydrase XIII

31 Gene Product Result for
Synonyms: CAXIII
UniProtKB ID: Q8N1Q1
Gene ID:
Human(377677) Summary: Carbonic anhydrases (CAs) are a family of zinc metalloenzymes. For background information on the CA family, see MIM 114800.[supplied by OMIM, Mar 2008]
cow(513850) carbonic anhydrase XIII
domestic cat(101094155) carbonic anhydrase XIII
dog(487030) carbonic anhydrase XIII
domestic guinea pig(100721211) carbonic anhydrase XIII
naked mole-rat(101700860) carbonic anhydrase XIII
sheep(101113860) carbonic anhydrase XIII
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1299 Human CA13 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198584 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028531 MISSION® esiRNA esiRNA human CA13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198584 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206534 predicted 979
2 SASI_Hs01_00206536 predicted 912
3 SASI_Hs02_00372227 predicted 371
4 SASI_Hs02_00372228 predicted 697
5 SASI_Hs02_00372229 predicted 822
6 SASI_Hs02_00372230 predicted 417
7 SASI_Hs01_00206538 predicted 857
8 SASI_Hs02_00372231 predicted 401
9 SASI_Hs02_00372232 predicted 476
10 SASI_Hs02_00372233 predicted 728
11 SASI_Hs01_00206535 predicted 235
12 SASI_Hs01_00206537 predicted 326
13 SASI_Hs01_00206539 predicted 672
14 SASI_Hs01_00206540 predicted 239
15 SASI_Hs01_00206541 predicted 394
16 SASI_Hs01_00206542 predicted 651
17 SASI_Hs01_00206543 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198584
CA13 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase XIII
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-646s1c1
Sequence:CCGGCTTACAGTTCCACCTCTTCTTCTCGAGAAGAAGAGGTGGAACTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-566s1c1
Sequence:CCGGGTAAACAAACTCGATTCACAACTCGAGTTGTGAATCGAGTTTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198584.1-2669s1c1
Sequence:CCGGCCTCTCAAATTGCTGGAATTACTCGAGTAATTCCAGCAATTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-243s1c1
Sequence:CCGGCCATTCCTTCAATGTTGACTTCTCGAGAAGTCAACATTGAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198584.1-1781s1c1
Sequence:CCGGCCAGGATATAAATGGCTATTTCTCGAGAAATAGCCATTTATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-91s1c1
Sequence:CCGGCCTATTCACTGGAAGGAATTTCTCGAGAAATTCCTTCCAGTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-186s1c1
Sequence:CCGGCCGACCACTTAGTATCAAGTACTCGAGTACTTGATACTAAGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198584.2-1112s21c1
Sequence:CCGGTGAGAGCCTCTTTCCATTAAACTCGAGTTTAATGGAAAGAGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198584.2-789s21c1
Sequence:CCGAACAGATTGGTGAACCTAATTCCTCGAGGAATTAGGTTCACCAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198584
CA13 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase XIII
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-646s1c1
Sequence:CCGGCTTACAGTTCCACCTCTTCTTCTCGAGAAGAAGAGGTGGAACTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-566s1c1
Sequence:CCGGGTAAACAAACTCGATTCACAACTCGAGTTGTGAATCGAGTTTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198584.1-2669s1c1
Sequence:CCGGCCTCTCAAATTGCTGGAATTACTCGAGTAATTCCAGCAATTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-243s1c1
Sequence:CCGGCCATTCCTTCAATGTTGACTTCTCGAGAAGTCAACATTGAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198584.1-1781s1c1
Sequence:CCGGCCAGGATATAAATGGCTATTTCTCGAGAAATAGCCATTTATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-91s1c1
Sequence:CCGGCCTATTCACTGGAAGGAATTTCTCGAGAAATTCCTTCCAGTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-186s1c1
Sequence:CCGGCCGACCACTTAGTATCAAGTACTCGAGTACTTGATACTAAGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198584.2-1112s21c1
Sequence:CCGGTGAGAGCCTCTTTCCATTAAACTCGAGTTTAATGGAAAGAGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198584.2-789s21c1
Sequence:CCGAACAGATTGGTGAACCTAATTCCTCGAGGAATTAGGTTCACCAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198584
CA13 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase XIII
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-646s1c1
Sequence:CCGGCTTACAGTTCCACCTCTTCTTCTCGAGAAGAAGAGGTGGAACTGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-566s1c1
Sequence:CCGGGTAAACAAACTCGATTCACAACTCGAGTTGTGAATCGAGTTTGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159986    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198584.1-2669s1c1
Sequence:CCGGCCTCTCAAATTGCTGGAATTACTCGAGTAATTCCAGCAATTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-243s1c1
Sequence:CCGGCCATTCCTTCAATGTTGACTTCTCGAGAAGTCAACATTGAAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198584.1-1781s1c1
Sequence:CCGGCCAGGATATAAATGGCTATTTCTCGAGAAATAGCCATTTATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-91s1c1
Sequence:CCGGCCTATTCACTGGAAGGAATTTCTCGAGAAATTCCTTCCAGTGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198584.1-186s1c1
Sequence:CCGGCCGACCACTTAGTATCAAGTACTCGAGTACTTGATACTAAGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198584.2-1112s21c1
Sequence:CCGGTGAGAGCCTCTTTCCATTAAACTCGAGTTTAATGGAAAGAGGCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198584.2-789s21c1
Sequence:CCGAACAGATTGGTGAACCTAATTCCTCGAGGAATTAGGTTCACCAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks