EMAIL THIS PAGE TO A FRIEND

CA14

carbonic anhydrase XIV

32 Gene Product Result for
Synonyms: CAXiV
UniProtKB ID: Q9ULX7, Q5TB24, Q8NCF4
Gene ID:
Human(23632) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XIV is predicted to be a type I membrane protein and shares highest sequence similarity with the other transmembrane CA isoform, CA XII; however, they have different patterns of tissue-specific expression and thus may play different physiologic roles. [provided by RefSeq, Jul 2008]
sheep(101103199) carbonic anhydrase XIV
naked mole-rat(101718354) carbonic anhydrase XIV
domestic guinea pig(100728292) carbonic anhydrase XIV
Zebrafish(567897) carbonic anhydrase XIV
cow(509027) carbonic anhydrase XIV
domestic cat(101082932) carbonic anhydrase XIV
chicken(431476) carbonic anhydrase XIV
dog(483180) carbonic anhydrase XIV
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing
A6011 Acetazolamide ≥99%, powder human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1300 Human CA14 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012113 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047281 MISSION® esiRNA esiRNA human CA14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012113 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077848 predicted 801
2 SASI_Hs01_00077850 predicted 1046
3 SASI_Hs01_00077851 predicted 533
4 SASI_Hs01_00077853 predicted 1402
5 SASI_Hs01_00077854 predicted 1106
6 SASI_Hs01_00077855 predicted 1153
7 SASI_Hs01_00077856 predicted 713
8 SASI_Hs02_00343645 predicted 806
9 SASI_Hs01_00077857 predicted 1365
10 SASI_Hs02_00343646 predicted 1350
11 SASI_Hs01_00077849 predicted 710
12 SASI_Hs01_00077852 predicted 1336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012113
CA14 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase XIV
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-705s21c1
Sequence:CCGGAGAGCTCCACATTGTACATTACTCGAGTAATGTACAATGTGGAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-1305s21c1
Sequence:CCGGAGCCACGACTGAGGCATAAATCTCGAGATTTATGCCTCAGTCGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-781s21c1
Sequence:CCGGGCTGTCCTGGGCATCCTAATTCTCGAGAATTAGGATGCCCAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-535s1c1
Sequence:CCGGCCTTTGGACCTGCACAACAATCTCGAGATTGTTGTGCAGGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-809s1c1
Sequence:CCGGGTGAGACTAAGAATATAGCTTCTCGAGAAGCTATATTCTTAGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012113.1-1563s1c1
Sequence:CCGGGAGAACAAACTCTGTTTAGTTCTCGAGAACTAAACAGAGTTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-453s1c1
Sequence:CCGGCGATATTCAGACAGACAGTGTCTCGAGACACTGTCTGTCTGAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012113.1-1546s1c1
Sequence:CCGGGCTGTGTTGTTAATGCAGAGACTCGAGTCTCTGCATTAACAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-1239s1c1
Sequence:CCGGCATTGCTAGAAAGATTCGGAACTCGAGTTCCGAATCTTTCTAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012113
CA14 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase XIV
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-705s21c1
Sequence:CCGGAGAGCTCCACATTGTACATTACTCGAGTAATGTACAATGTGGAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-1305s21c1
Sequence:CCGGAGCCACGACTGAGGCATAAATCTCGAGATTTATGCCTCAGTCGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-781s21c1
Sequence:CCGGGCTGTCCTGGGCATCCTAATTCTCGAGAATTAGGATGCCCAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-535s1c1
Sequence:CCGGCCTTTGGACCTGCACAACAATCTCGAGATTGTTGTGCAGGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-809s1c1
Sequence:CCGGGTGAGACTAAGAATATAGCTTCTCGAGAAGCTATATTCTTAGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012113.1-1563s1c1
Sequence:CCGGGAGAACAAACTCTGTTTAGTTCTCGAGAACTAAACAGAGTTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-453s1c1
Sequence:CCGGCGATATTCAGACAGACAGTGTCTCGAGACACTGTCTGTCTGAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012113.1-1546s1c1
Sequence:CCGGGCTGTGTTGTTAATGCAGAGACTCGAGTCTCTGCATTAACAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-1239s1c1
Sequence:CCGGCATTGCTAGAAAGATTCGGAACTCGAGTTCCGAATCTTTCTAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012113
CA14 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase XIV
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-705s21c1
Sequence:CCGGAGAGCTCCACATTGTACATTACTCGAGTAATGTACAATGTGGAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-1305s21c1
Sequence:CCGGAGCCACGACTGAGGCATAAATCTCGAGATTTATGCCTCAGTCGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012113.1-781s21c1
Sequence:CCGGGCTGTCCTGGGCATCCTAATTCTCGAGAATTAGGATGCCCAGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-535s1c1
Sequence:CCGGCCTTTGGACCTGCACAACAATCTCGAGATTGTTGTGCAGGTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-809s1c1
Sequence:CCGGGTGAGACTAAGAATATAGCTTCTCGAGAAGCTATATTCTTAGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012113.1-1563s1c1
Sequence:CCGGGAGAACAAACTCTGTTTAGTTCTCGAGAACTAAACAGAGTTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-453s1c1
Sequence:CCGGCGATATTCAGACAGACAGTGTCTCGAGACACTGTCTGTCTGAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012113.1-1546s1c1
Sequence:CCGGGCTGTGTTGTTAATGCAGAGACTCGAGTCTCTGCATTAACAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012113.1-1239s1c1
Sequence:CCGGCATTGCTAGAAAGATTCGGAACTCGAGTTCCGAATCTTTCTAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks