EMAIL THIS PAGE TO A FRIEND

CA1

carbonic anhydrase I

122 Gene Product Result for
Synonyms: CA-I CAB Car1
UniProtKB ID: P00915
Gene ID:
Human(759) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA1 is closely linked to CA2 and CA3 genes on chromosome 8, and it encodes a cytosolic protein which is found at the highest level in erythrocytes. Variants of this gene have been described in some populations. Multiple alternatively spliced variants, encoding the same protein, have been identified. Transcript variants of CA1 utilizing alternative polyA_sites have been described in literature. [provided by RefSeq, Sep 2009]
Rat(310218) carbonic anhydrase I
Thale Cress(821134) carbonic anhydrase 1
cow(510801) carbonic anhydrase I
domestic cat(101094399) carbonic anhydrase I
dog(487031) carbonic anhydrase I
sheep(101113601) carbonic anhydrase I
sheep(443309) carbonic anhydrase I
naked mole-rat(101698182) carbonic anhydrase I
domestic guinea pig(100720116) carbonic anhydrase I
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Activator

Product # Description Species Add to Cart
 
408468 Boc-Asp-OH 99% human pricing
H3751 D-Histidine ≥98% (TLC) human pricing
53321 D-Histidine puriss., ≥99.0% (T) human pricing
P1751 D-Phenylalanine ≥98% (HPLC) human pricing
A7469 L-Alanine from non-animal source, meets EP, USP testing specifications, suitable for cell culture, ≥98.5% human pricing
A4349 L-Alanine PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human pricing
05129 L-Alanine BioUltra, ≥99.5% (NT) human pricing
W381829 L-Alanine ≥99% human pricing
A7627 L-Alanine ≥98% (TLC) human pricing
C9625 L-Carnosine ~99%, crystalline human pricing
H6034 L-Histidine cell culture tested, meets EP, USP testing specifications, from non-animal source human pricing
H8000 L-Histidine ReagentPlus®, ≥99% (TLC) human pricing
H3911 L-Histidine PharmaGrade, Ajinomoto, EP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human pricing
53319 L-Histidine BioUltra, ≥99.5% (NT) human pricing
P2126 L-Phenylalanine reagent grade, ≥98% human pricing
P5482 L-Phenylalanine from non-animal source, meets EP, JP, USP testing specifications, suitable for cell culture, 98.5-101.0% human pricing
P8740 L-Phenylalanine PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human pricing
78019 L-Phenylalanine BioUltra, ≥99.0% (NT) human pricing
W358509 L-Phenylalanine 99%, FCC human pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
A9502 Ala-Ala human, rat pricing
H7125 Histamine ≥97.0% human, rat pricing
53290 Histamine base, ≥97.0% (NT) human, rat pricing
A5474 L-Aspartic acid PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
A9256 L-Aspartic acid reagent grade, ≥98% (HPLC) human, rat pricing
A8949 L-Aspartic acid BioXtra, ≥99% (HPLC) human, rat pricing
A7219 L-Aspartic acid from non-animal source, meets EP, USP testing specifications, suitable for cell culture, 98.5-101.0% human, rat pricing
A4534 L-Aspartic acid BioReagent, suitable for cell culture, suitable for insect cell culture human, rat pricing
11189 L-Aspartic acid BioUltra, ≥99.5% (T) human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S8010 (±)-Sulpiride human pricing
09575 4-Amino-6-(trifluoromethyl)benzene-1,3-disulfonamide technical, ≥96% (HPLC) human pricing
308560 4-Amino-6-chloro-1,3-benzenedisulfonamide 98% human pricing
C11804 4-Sulfamoylbenzoic acid 97% human pricing
108146 Benzenesulfonamide ≥98% human pricing
C4911 Chlorothiazide thiazide diuretic human pricing
E3258 Ethinamate analytical standard human pricing
H4759 Hydrochlorothiazide crystalline human pricing
H2910 Hydrochlorothiazide meets USP testing specifications human pricing
H4512 Hydrochlorothiazide drug standard, 1.0 mg/mL in methanol human pricing
H8627 Hydroxyurea 98%, powder human pricing
245232 Methyl 2-(aminosulfonyl)benzoate 98% human pricing
236330 p-Toluenesulfonamide ReagentPlus®, ≥99% human pricing
105902 p-Toluenesulfonamide reagent grade, 98% human pricing
T0899 Stearyl trichloroacetate ~95% human pricing
481505 Sulfamic acid 99.999% trace metals basis human pricing
383120 Sulfamic acid ACS reagent, 99.3% human pricing
242772 Sulfamic acid ReagentPlus®, ≥99% human pricing
242780 Sulfamic acid reagent grade, 98% human pricing
07401 Sulfamic acid ≥99.5% (alkalimetric) human pricing
86033 Sulfamide purum, ≥99.0% (N) human pricing
211370 Sulfamide 99% human pricing
245887 2-Aminobenzenesulfonamide 98% human, mouse pricing
275247 4-(2-Aminoethyl)benzenesulfonamide 99% human, mouse pricing
A2134 4-Aminomethylbenzenesulfonamide hydrochloride analytical standard, ≥95% human, mouse pricing
333328 6-Ethoxy-2-benzothiazolesulfonamide 97% human, mouse pricing
S9251 Sulfanilamide ≥99% human, mouse pricing
46874 Sulfanilamide VETRANAL, analytical standard human, mouse pricing
33626 Sulfanilamide puriss. p.a., ≥99% (calc. to the dried substance) human, mouse pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
A6011 Acetazolamide ≥99%, powder human, mouse, rat pricing
U7129 Urea solution 40 % (w/v) in H2O human, mouse, rat pricing
51457 Urea solution BioUltra, ~8 M in H2O human, mouse, rat pricing
299367 Urea-12C 99.9 atom % 12C human, mouse, rat pricing
594687 α-Sexithiophene human, rat pricing
C9847 Cyclothiazide human, rat pricing
U0631 Urea BioXtra, pH 7.5-9.5 (20 °C, 5 M in H2O) human, rat pricing
U5378 Urea powder, BioReagent, for molecular biology, suitable for cell culture human, rat pricing
U4883 Urea 8 M (after reconstitution with 16 mL high purity water) human, rat pricing
U6504 Urea for electrophoresis human, rat pricing
U4884 Urea meets USP testing specifications human, rat pricing
U4128 Urea BioReagent, suitable for cell culture human, rat pricing
U5128 Urea ACS reagent, 99.0-100.5% human, rat pricing
U1250 Urea ReagentPlus®, ≥99.5%, pellets human, rat pricing
51456 Urea BioUltra, for molecular biology, ≥99.5% (T) human, rat pricing
33247 Urea puriss. p.a., ACS reagent, reag. Ph. Eur., ≥99.5% human, rat pricing
51465 Urea tested according to Ph.Eur. human, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1297 Human CA1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143231 MISSION® esiRNA esiRNA human CA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001738 Rosetta Predictions human pricing
NM_001107660 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210773 predicted 447
2 SASI_Hs01_00210774 predicted 454
3 SASI_Hs01_00210775 predicted 507
4 SASI_Hs02_00332453 predicted 566
5 SASI_Hs01_00210777 predicted 477
6 SASI_Hs01_00210778 predicted 276
7 SASI_Hs01_00210780 predicted 731
8 SASI_Hs01_00210781 predicted 275
9 SASI_Hs01_00210782 predicted 745
10 SASI_Hs02_00332454 predicted 763
11 SASI_Hs01_00210776 predicted 269
12 SASI_Hs01_00210779 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231015 predicted 422
2 SASI_Rn02_00231016 predicted 270
3 SASI_Rn02_00231017 predicted 215
4 SASI_Rn02_00231018 predicted 637
5 SASI_Rn02_00231019 predicted 838
6 SASI_Rn02_00231020 predicted 707
7 SASI_Rn02_00231021 predicted 912
8 SASI_Rn02_00231022 predicted 263
9 SASI_Rn02_00231023 predicted 724
10 SASI_Rn02_00231024 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001738
CA1 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase I
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001738.1-1048s1c1
Sequence:CCGGGCCTTCAAATCAATCTGTAAACTCGAGTTTACAGATTGATTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-828s1c1
Sequence:CCGGCGCAGCCTTCTATCAAATGTTCTCGAGAACATTTGATAGAAGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-368s1c1
Sequence:CCGGCGATAACCGATCAGTGCTGAACTCGAGTTCAGCACTGATCGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-754s1c1
Sequence:CCGGCTCTTTATGAGAGTGTAACTTCTCGAGAAGTTACACTCTCATAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-561s1c1
Sequence:CCGGGCTGATGGTTTGGCAGTTATTCTCGAGAATAACTGCCAAACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001738.3-336s21c1
Sequence:CCGGGGGCATTCCTTCCATGTAAATCTCGAGATTTACATGGAAGGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001738.3-633s21c1
Sequence:CCGGGATGCCCTCCAAGCAATTAAACTCGAGTTTAATTGCTTGGAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001738
CA1 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase I
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001738.1-1048s1c1
Sequence:CCGGGCCTTCAAATCAATCTGTAAACTCGAGTTTACAGATTGATTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-828s1c1
Sequence:CCGGCGCAGCCTTCTATCAAATGTTCTCGAGAACATTTGATAGAAGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-368s1c1
Sequence:CCGGCGATAACCGATCAGTGCTGAACTCGAGTTCAGCACTGATCGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-754s1c1
Sequence:CCGGCTCTTTATGAGAGTGTAACTTCTCGAGAAGTTACACTCTCATAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-561s1c1
Sequence:CCGGGCTGATGGTTTGGCAGTTATTCTCGAGAATAACTGCCAAACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001738.3-336s21c1
Sequence:CCGGGGGCATTCCTTCCATGTAAATCTCGAGATTTACATGGAAGGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001738.3-633s21c1
Sequence:CCGGGATGCCCTCCAAGCAATTAAACTCGAGTTTAATTGCTTGGAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001738
CA1 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase I
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001738.1-1048s1c1
Sequence:CCGGGCCTTCAAATCAATCTGTAAACTCGAGTTTACAGATTGATTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-828s1c1
Sequence:CCGGCGCAGCCTTCTATCAAATGTTCTCGAGAACATTTGATAGAAGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-368s1c1
Sequence:CCGGCGATAACCGATCAGTGCTGAACTCGAGTTCAGCACTGATCGGTTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-754s1c1
Sequence:CCGGCTCTTTATGAGAGTGTAACTTCTCGAGAAGTTACACTCTCATAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001738.1-561s1c1
Sequence:CCGGGCTGATGGTTTGGCAGTTATTCTCGAGAATAACTGCCAAACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001738.3-336s21c1
Sequence:CCGGGGGCATTCCTTCCATGTAAATCTCGAGATTTACATGGAAGGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001738.3-633s21c1
Sequence:CCGGGATGCCCTCCAAGCAATTAAACTCGAGTTTAATTGCTTGGAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks