EMAIL THIS PAGE TO A FRIEND

CA2

carbonic anhydrase II

164 Gene Product Result for
Synonyms: CA-II CAC CAII Car2
Species: Human CA2(760), Zebrafish ca2(387526), cow CA2(280740), domestic cat CA2(101094903), dog CA2(477928), chicken CA2(396257), Thale Cress CA2(831326), naked mole-rat Ca2(101697802), domestic guinea pig Ca2(100719293), sheep CA2(101113341), Domestic Rabbit CA2(100009156)
UniProtKB ID: P00918, B2R7G8, Q6FI12, Q96ET9
Gene ID:
Human(760) Summary: CA2 is one of several (at least 7) isozymes of carbonic anhydrase. Carbonic anhydrase catalyzes reversible hydration of carbon dioxide. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. [provided by RefSeq, Jul 2008]
Zebrafish(387526) carbonic anhydrase II
cow(280740) carbonic anhydrase II
domestic cat(101094903) carbonic anhydrase II
dog(477928) carbonic anhydrase II
chicken(396257) carbonic anhydrase II
Thale Cress(831326) carbonic anhydrase 2
naked mole-rat(101697802) carbonic anhydrase II
domestic guinea pig(100719293) carbonic anhydrase II
sheep(101113341) carbonic anhydrase II
Domestic Rabbit(100009156) carbonic anhydrase II
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Activator

Product # Description Species Add to Cart
 
408468 Boc-Asp-OH 99% human pricing
H3751 D-Histidine ≥98% (TLC) human pricing
53321 D-Histidine puriss., ≥99.0% (T) human pricing
P1751 D-Phenylalanine ≥98% (HPLC) human pricing
A7469 L-Alanine from non-animal source, meets EP, USP testing specifications, suitable for cell culture, ≥98.5% human pricing
A4349 L-Alanine PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human pricing
05129 L-Alanine BioUltra, ≥99.5% (NT) human pricing
W381829 L-Alanine ≥99% human pricing
A7627 L-Alanine ≥98% (TLC) human pricing
C9625 L-Carnosine ~99%, crystalline human pricing
H6034 L-Histidine cell culture tested, meets EP, USP testing specifications, from non-animal source human pricing
H8000 L-Histidine ReagentPlus®, ≥99% (TLC) human pricing
H3911 L-Histidine PharmaGrade, Ajinomoto, EP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human pricing
53319 L-Histidine BioUltra, ≥99.5% (NT) human pricing
P2126 L-Phenylalanine reagent grade, ≥98% human pricing
P5482 L-Phenylalanine from non-animal source, meets EP, JP, USP testing specifications, suitable for cell culture, 98.5-101.0% human pricing
P8740 L-Phenylalanine PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human pricing
78019 L-Phenylalanine BioUltra, ≥99.0% (NT) human pricing
W358509 L-Phenylalanine 99%, FCC human pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
A9502 Ala-Ala human, rat pricing
H7125 Histamine ≥97.0% human, rat pricing
53290 Histamine base, ≥97.0% (NT) human, rat pricing
A5474 L-Aspartic acid PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
A9256 L-Aspartic acid reagent grade, ≥98% (HPLC) human, rat pricing
A8949 L-Aspartic acid BioXtra, ≥99% (HPLC) human, rat pricing
A7219 L-Aspartic acid from non-animal source, meets EP, USP testing specifications, suitable for cell culture, 98.5-101.0% human, rat pricing
A4534 L-Aspartic acid BioReagent, suitable for cell culture, suitable for insect cell culture human, rat pricing
11189 L-Aspartic acid BioUltra, ≥99.5% (T) human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S8010 (±)-Sulpiride human pricing
562963 3-Methyl-1-(4′-sulfoamidophenyl)-5-pyrazolone 95% human pricing
09575 4-Amino-6-(trifluoromethyl)benzene-1,3-disulfonamide technical, ≥96% (HPLC) human pricing
308560 4-Amino-6-chloro-1,3-benzenedisulfonamide 98% human pricing
N27802 4-Nitro-3-(trifluoromethyl)phenol 99% (GC) human pricing
C11804 4-Sulfamoylbenzoic acid 97% human pricing
159034 Acetohydroxamic acid 98% human pricing
H4759 Hydrochlorothiazide crystalline human pricing
H2910 Hydrochlorothiazide meets USP testing specifications human pricing
H8627 Hydroxyurea 98%, powder human pricing
245232 Methyl 2-(aminosulfonyl)benzoate 98% human pricing
236330 p-Toluenesulfonamide ReagentPlus®, ≥99% human pricing
105902 p-Toluenesulfonamide reagent grade, 98% human pricing
T0899 Stearyl trichloroacetate ~95% human pricing
481505 Sulfamic acid 99.999% trace metals basis human pricing
383120 Sulfamic acid ACS reagent, 99.3% human pricing
242772 Sulfamic acid ReagentPlus®, ≥99% human pricing
242780 Sulfamic acid reagent grade, 98% human pricing
07401 Sulfamic acid ≥99.5% (alkalimetric) human pricing
86033 Sulfamide purum, ≥99.0% (N) human pricing
211370 Sulfamide 99% human pricing
638455 Trifluoromethanesulfonamide 95% human pricing
245887 2-Aminobenzenesulfonamide 98% human, mouse pricing
275247 4-(2-Aminoethyl)benzenesulfonamide 99% human, mouse pricing
A2134 4-Aminomethylbenzenesulfonamide hydrochloride analytical standard, ≥95% human, mouse pricing
333328 6-Ethoxy-2-benzothiazolesulfonamide 97% human, mouse pricing
S9251 Sulfanilamide ≥99% human, mouse pricing
46874 Sulfanilamide VETRANAL, analytical standard human, mouse pricing
33626 Sulfanilamide puriss. p.a., ≥99% (calc. to the dried substance) human, mouse pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
A6011 Acetazolamide ≥99%, powder human, mouse, rat pricing
U7129 Urea solution 40 % (w/v) in H2O human, mouse, rat pricing
51457 Urea solution BioUltra, ~8 M in H2O human, mouse, rat pricing
299367 Urea-12C 99.9 atom % 12C human, mouse, rat pricing
594687 α-Sexithiophene human, rat pricing
U0631 Urea BioXtra, pH 7.5-9.5 (20 °C, 5 M in H2O) human, rat pricing
U5378 Urea powder, BioReagent, for molecular biology, suitable for cell culture human, rat pricing
U4883 Urea 8 M (after reconstitution with 16 mL high purity water) human, rat pricing
U6504 Urea for electrophoresis human, rat pricing
U4884 Urea meets USP testing specifications human, rat pricing
U4128 Urea BioReagent, suitable for cell culture human, rat pricing
U5128 Urea ACS reagent, 99.0-100.5% human, rat pricing
U1250 Urea ReagentPlus®, ≥99.5%, pellets human, rat pricing
51456 Urea BioUltra, for molecular biology, ≥99.5% (T) human, rat pricing
33247 Urea puriss. p.a., ACS reagent, reag. Ph. Eur., ≥99.5% human, rat pricing
51465 Urea tested according to Ph.Eur. human, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1301 Human CA2 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0683 AQUA Peptide EPISVSSEQVL[K] human pricing
AQ0684 AQUA Peptide AVQQPDGLAVLGIFL[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000067 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155141 MISSION® esiRNA esiRNA human CA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000067 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095129 predicted 917
2 SASI_Hs01_00095130 predicted 966
3 SASI_Hs02_00301788 predicted 840
4 SASI_Hs01_00095131 predicted 1013
5 SASI_Hs01_00095132 predicted 968
6 SASI_Hs01_00095135 predicted 517
7 SASI_Hs02_00301789 predicted 686
8 SASI_Hs02_00301790 predicted 280
9 SASI_Hs02_00301791 predicted 997
10 SASI_Hs02_00301792 predicted 630
11 SASI_Hs01_00095128 predicted 327
12 SASI_Hs01_00095133 predicted 221
13 SASI_Hs01_00095134 predicted 397
14 SASI_Hs01_00095136 predicted 258
15 SASI_Hs01_00095137 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000067
VALIDATED
CA2 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase II
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000067.1-242s1c1
Sequence:CCGGCCTCAACAATGGTCATGCTTTCTCGAGAAAGCATGACCATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-1051s1c1
Sequence:CCGGGCTTTGTTTATGGTAGTAGTTCTCGAGAACTACTACCATAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-726s1c1
Sequence:CCGGCAGGTGTTGAAATTCCGTAAACTCGAGTTTACGGAATTTCAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-725s1c1
Sequence:CCGGGCAGGTGTTGAAATTCCGTAACTCGAGTTACGGAATTTCAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-619s21c1
Sequence:CCGGTTGAAGGTTGGCAGCGCTAAACTCGAGTTTAGCGCTGCCAACCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-661s21c1
Sequence:CCGGGATGTGCTGGATTCCATTAAACTCGAGTTTAATGGAATCCAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000067.2-357s21c1
Sequence:CCGGCCTCAACAATGGTCATGCTTTCTCGAGAAAGCATGACCATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-840s21c1
Sequence:CCGGGCAGGTGTTGAAATTCCGTAACTCGAGTTACGGAATTTCAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000067.2-1166s21c1
Sequence:CCGGGCTTTGTTTATGGTAGTAGTTCTCGAGAACTACTACCATAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000067
VALIDATED
CA2 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase II
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000067.1-242s1c1
Sequence:CCGGCCTCAACAATGGTCATGCTTTCTCGAGAAAGCATGACCATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-1051s1c1
Sequence:CCGGGCTTTGTTTATGGTAGTAGTTCTCGAGAACTACTACCATAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-726s1c1
Sequence:CCGGCAGGTGTTGAAATTCCGTAAACTCGAGTTTACGGAATTTCAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-725s1c1
Sequence:CCGGGCAGGTGTTGAAATTCCGTAACTCGAGTTACGGAATTTCAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-619s21c1
Sequence:CCGGTTGAAGGTTGGCAGCGCTAAACTCGAGTTTAGCGCTGCCAACCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-661s21c1
Sequence:CCGGGATGTGCTGGATTCCATTAAACTCGAGTTTAATGGAATCCAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000067.2-357s21c1
Sequence:CCGGCCTCAACAATGGTCATGCTTTCTCGAGAAAGCATGACCATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-840s21c1
Sequence:CCGGGCAGGTGTTGAAATTCCGTAACTCGAGTTACGGAATTTCAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000067.2-1166s21c1
Sequence:CCGGGCTTTGTTTATGGTAGTAGTTCTCGAGAACTACTACCATAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000067
VALIDATED
CA2 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase II
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000067.1-242s1c1
Sequence:CCGGCCTCAACAATGGTCATGCTTTCTCGAGAAAGCATGACCATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-1051s1c1
Sequence:CCGGGCTTTGTTTATGGTAGTAGTTCTCGAGAACTACTACCATAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-726s1c1
Sequence:CCGGCAGGTGTTGAAATTCCGTAAACTCGAGTTTACGGAATTTCAACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000067.1-725s1c1
Sequence:CCGGGCAGGTGTTGAAATTCCGTAACTCGAGTTACGGAATTTCAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-619s21c1
Sequence:CCGGTTGAAGGTTGGCAGCGCTAAACTCGAGTTTAGCGCTGCCAACCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-661s21c1
Sequence:CCGGGATGTGCTGGATTCCATTAAACTCGAGTTTAATGGAATCCAGCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000067.2-357s21c1
Sequence:CCGGCCTCAACAATGGTCATGCTTTCTCGAGAAAGCATGACCATTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000067.2-840s21c1
Sequence:CCGGGCAGGTGTTGAAATTCCGTAACTCGAGTTACGGAATTTCAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000067.2-1166s21c1
Sequence:CCGGGCTTTGTTTATGGTAGTAGTTCTCGAGAACTACTACCATAAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks