EMAIL THIS PAGE TO A FRIEND

CA3

carbonic anhydrase III, muscle specific

29 Gene Product Result for
Synonyms: CAIII Car3
UniProtKB ID: P07451, B2R867, B3KUC8, O60842
Gene ID:
Human(761) Summary: Carbonic anhydrase III (CAIII) is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. These carbonic anhydrases are a class of metalloenzymes that catalyze the reversible hydration of carbon dioxide and are differentially expressed in a number of cell types. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. A proportion of carriers of Duchenne muscle dystrophy have a higher CA3 level than normal. The gene spans 10.3 kb and contains seven exons and six introns. [provided by RefSeq, Oct 2008]
chicken(420208) carbonic anhydrase III, muscle specific
cow(513212) carbonic anhydrase III, muscle specific
Horse(100050125) carbonic anhydrase III, muscle specific
domestic cat(101094650) carbonic anhydrase III, muscle specific
dog(487032) carbonic anhydrase III, muscle specific
naked mole-rat(101699292) carbonic anhydrase III, muscle specific
domestic guinea pig(100306971) carbonic anhydrase 3
sheep(101118196) carbonic anhydrase III, muscle specific
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing
A6011 Acetazolamide ≥99%, powder human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1303 Human CA3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005181 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013671 MISSION® esiRNA esiRNA targeting human CA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005181 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136446 predicted 783
2 SASI_Hs01_00136448 predicted 1017
3 SASI_Hs01_00136449 predicted 1630
4 SASI_Hs01_00136450 predicted 1653
5 SASI_Hs01_00136451 predicted 1630
6 SASI_Hs01_00136452 predicted 1680
7 SASI_Hs01_00136453 predicted 1536
8 SASI_Hs01_00136454 predicted 1659
9 SASI_Hs01_00136455 predicted 1535
10 SASI_Hs02_00339129 predicted 1596
11 SASI_Hs01_00136447 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005181
CA3 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase III, muscle specific
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005181.3-499s21c1
Sequence:CCGGGGATCGCTGTGATTGGCATTTCTCGAGAAATGCCAATCACAGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-1033s21c1
Sequence:CCGGTTACTTTCGACAAGATCTAATCTCGAGATTAGATCTTGTCGAAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-941s21c1
Sequence:CCGGCTCCTTACTCCAAGTCTATTTCTCGAGAAATAGACTTGGAGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-1294s21c1
Sequence:CCGGAGGTGTATGAAGATCATATAACTCGAGTTATATGATCTTCATACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005181.2-771s1c1
Sequence:CCGGCCCGTTGAGCTGCATACTAAACTCGAGTTTAGTATGCAGCTCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1990s1c1
Sequence:CCGGCCAGCAAGAAGTCAGTCATTTCTCGAGAAATGACTGACTTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005181.2-2023s1c1
Sequence:CCGGGCTACTAAGATTACTTGGTTTCTCGAGAAACCAAGTAATCTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005181.2-1175s1c1
Sequence:CCGGCAAGATTAAGACAAAGGGCAACTCGAGTTGCCCTTTGTCTTAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1948s1c1
Sequence:CCGGGACAGCAAGAATTGAGCTAATCTCGAGATTAGCTCAATTCTTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1738s1c1
Sequence:CCGGGAAACAGAGATGGAAGAGTAACTCGAGTTACTCTTCCATCTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005181.2-1052s1c1
Sequence:CCGGGAACCCGAAGTATAACACTTTCTCGAGAAAGTGTTATACTTCGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005181
CA3 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase III, muscle specific
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005181.3-499s21c1
Sequence:CCGGGGATCGCTGTGATTGGCATTTCTCGAGAAATGCCAATCACAGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-1033s21c1
Sequence:CCGGTTACTTTCGACAAGATCTAATCTCGAGATTAGATCTTGTCGAAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-941s21c1
Sequence:CCGGCTCCTTACTCCAAGTCTATTTCTCGAGAAATAGACTTGGAGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-1294s21c1
Sequence:CCGGAGGTGTATGAAGATCATATAACTCGAGTTATATGATCTTCATACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005181.2-771s1c1
Sequence:CCGGCCCGTTGAGCTGCATACTAAACTCGAGTTTAGTATGCAGCTCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1990s1c1
Sequence:CCGGCCAGCAAGAAGTCAGTCATTTCTCGAGAAATGACTGACTTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005181.2-2023s1c1
Sequence:CCGGGCTACTAAGATTACTTGGTTTCTCGAGAAACCAAGTAATCTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005181.2-1175s1c1
Sequence:CCGGCAAGATTAAGACAAAGGGCAACTCGAGTTGCCCTTTGTCTTAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1948s1c1
Sequence:CCGGGACAGCAAGAATTGAGCTAATCTCGAGATTAGCTCAATTCTTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1738s1c1
Sequence:CCGGGAAACAGAGATGGAAGAGTAACTCGAGTTACTCTTCCATCTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005181.2-1052s1c1
Sequence:CCGGGAACCCGAAGTATAACACTTTCTCGAGAAAGTGTTATACTTCGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005181
CA3 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase III, muscle specific
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005181.3-499s21c1
Sequence:CCGGGGATCGCTGTGATTGGCATTTCTCGAGAAATGCCAATCACAGCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-1033s21c1
Sequence:CCGGTTACTTTCGACAAGATCTAATCTCGAGATTAGATCTTGTCGAAAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-941s21c1
Sequence:CCGGCTCCTTACTCCAAGTCTATTTCTCGAGAAATAGACTTGGAGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005181.3-1294s21c1
Sequence:CCGGAGGTGTATGAAGATCATATAACTCGAGTTATATGATCTTCATACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005181.2-771s1c1
Sequence:CCGGCCCGTTGAGCTGCATACTAAACTCGAGTTTAGTATGCAGCTCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1990s1c1
Sequence:CCGGCCAGCAAGAAGTCAGTCATTTCTCGAGAAATGACTGACTTCTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005181.2-2023s1c1
Sequence:CCGGGCTACTAAGATTACTTGGTTTCTCGAGAAACCAAGTAATCTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005181.2-1175s1c1
Sequence:CCGGCAAGATTAAGACAAAGGGCAACTCGAGTTGCCCTTTGTCTTAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1948s1c1
Sequence:CCGGGACAGCAAGAATTGAGCTAATCTCGAGATTAGCTCAATTCTTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005181.2-1738s1c1
Sequence:CCGGGAAACAGAGATGGAAGAGTAACTCGAGTTACTCTTCCATCTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005181.2-1052s1c1
Sequence:CCGGGAACCCGAAGTATAACACTTTCTCGAGAAAGTGTTATACTTCGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks