EMAIL THIS PAGE TO A FRIEND

CA4

carbonic anhydrase IV

56 Gene Product Result for
Synonyms: CAIV Car4 RP17
Species: Human CA4(762), chicken CA4(417647), dog CA4(480591), domestic cat CA4(101088531), cow CA4(280741), sheep CA4(101109718), Domestic Rabbit CA4(100009226), domestic guinea pig Ca4(100731463), naked mole-rat Ca4(101700918)
UniProtKB ID: P22748
Gene ID:
Human(762) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]
chicken(417647) carbonic anhydrase IV
dog(480591) carbonic anhydrase IV
domestic cat(101088531) carbonic anhydrase IV
cow(280741) carbonic anhydrase IV
sheep(101109718) carbonic anhydrase IV
Domestic Rabbit(100009226) carbonic anhydrase IV
domestic guinea pig(100731463) carbonic anhydrase IV
naked mole-rat(101700918) carbonic anhydrase IV
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1304 Human CA4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000717 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036241 MISSION® esiRNA esiRNA human CA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144889 predicted 529
2 SASI_Hs01_00144891 predicted 325
3 SASI_Hs01_00144893 predicted 493
4 SASI_Hs02_00303130 predicted 585
5 SASI_Hs01_00144895 predicted 303
6 SASI_Hs01_00144896 predicted 419
7 SASI_Hs01_00144897 predicted 320
8 SASI_Hs01_00144898 predicted 453
9 SASI_Hs02_00303131 predicted 268
10 SASI_Hs02_00303132 predicted 727
11 SASI_Hs01_00144890 predicted 794
12 SASI_Hs01_00144892 predicted 781
13 SASI_Hs01_00144894 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000717
CA4 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase IV
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-823s1c1
Sequence:CCGGCAAGGAACAGACAGTGAGCATCTCGAGATGCTCACTGTCTGTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-460s1c1
Sequence:CCGGGATGCACATAGTACATGAGAACTCGAGTTCTCATGTACTATGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-316s1c1
Sequence:CCGGGATGATGTTGCTGGAGAACAACTCGAGTTGTTCTCCAGCAACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-267s1c1
Sequence:CCGGGCTACGATAAGAAGCAAACGTCTCGAGACGTTTGCTTCTTATCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-272s1c1
Sequence:CCGGGATAAGAAGCAAACGTGGACTCTCGAGAGTCCACGTTTGCTTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-264s1c1
Sequence:CCGGCTGGCTACGATAAGAAGCAAACTCGAGTTTGCTTCTTATCGTAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-618s1c1
Sequence:CCGGCCAAACCTGAGATGAGCACTACTCGAGTAGTGCTCATCTCAGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-452s1c1
Sequence:CCGGGCCATGGAGATGCACATAGTACTCGAGTACTATGTGCATCTCCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-785s1c1
Sequence:CCGGGAACAGATCCTGGCATTCTCTCTCGAGAGAGAATGCCAGGATCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-253s1c1
Sequence:CCGGCTTCTTCTTCTCTGGCTACGACTCGAGTCGTAGCCAGAGAAGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000717
CA4 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase IV
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-823s1c1
Sequence:CCGGCAAGGAACAGACAGTGAGCATCTCGAGATGCTCACTGTCTGTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-460s1c1
Sequence:CCGGGATGCACATAGTACATGAGAACTCGAGTTCTCATGTACTATGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-316s1c1
Sequence:CCGGGATGATGTTGCTGGAGAACAACTCGAGTTGTTCTCCAGCAACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-267s1c1
Sequence:CCGGGCTACGATAAGAAGCAAACGTCTCGAGACGTTTGCTTCTTATCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-272s1c1
Sequence:CCGGGATAAGAAGCAAACGTGGACTCTCGAGAGTCCACGTTTGCTTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-264s1c1
Sequence:CCGGCTGGCTACGATAAGAAGCAAACTCGAGTTTGCTTCTTATCGTAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-618s1c1
Sequence:CCGGCCAAACCTGAGATGAGCACTACTCGAGTAGTGCTCATCTCAGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-452s1c1
Sequence:CCGGGCCATGGAGATGCACATAGTACTCGAGTACTATGTGCATCTCCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-785s1c1
Sequence:CCGGGAACAGATCCTGGCATTCTCTCTCGAGAGAGAATGCCAGGATCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-253s1c1
Sequence:CCGGCTTCTTCTTCTCTGGCTACGACTCGAGTCGTAGCCAGAGAAGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000717
CA4 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase IV
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-823s1c1
Sequence:CCGGCAAGGAACAGACAGTGAGCATCTCGAGATGCTCACTGTCTGTTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-460s1c1
Sequence:CCGGGATGCACATAGTACATGAGAACTCGAGTTCTCATGTACTATGTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-316s1c1
Sequence:CCGGGATGATGTTGCTGGAGAACAACTCGAGTTGTTCTCCAGCAACATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-267s1c1
Sequence:CCGGGCTACGATAAGAAGCAAACGTCTCGAGACGTTTGCTTCTTATCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-272s1c1
Sequence:CCGGGATAAGAAGCAAACGTGGACTCTCGAGAGTCCACGTTTGCTTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-264s1c1
Sequence:CCGGCTGGCTACGATAAGAAGCAAACTCGAGTTTGCTTCTTATCGTAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-618s1c1
Sequence:CCGGCCAAACCTGAGATGAGCACTACTCGAGTAGTGCTCATCTCAGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-452s1c1
Sequence:CCGGGCCATGGAGATGCACATAGTACTCGAGTACTATGTGCATCTCCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000717.2-785s1c1
Sequence:CCGGGAACAGATCCTGGCATTCTCTCTCGAGAGAGAATGCCAGGATCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000717.2-253s1c1
Sequence:CCGGCTTCTTCTTCTCTGGCTACGACTCGAGTCGTAGCCAGAGAAGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)