EMAIL THIS PAGE TO A FRIEND

CA5A

carbonic anhydrase VA, mitochondrial

42 Gene Product Result for
Synonyms: CA5 CAV CAVA
UniProtKB ID: P35218, B2RPF2
Gene ID:
Human(763) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
dog(609174) carbonic anhydrase VA, mitochondrial
cow(515359) carbonic anhydrase VA, mitochondrial
naked mole-rat(101721438) carbonic anhydrase VA, mitochondrial
domestic guinea pig(100730118) carbonic anhydrase VA, mitochondrial
sheep(101106195) carbonic anhydrase VA, mitochondrial
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001739 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121431 MISSION® esiRNA esiRNA human CA5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001739 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332455 predicted 343
2 SASI_Hs01_00132799 predicted 516
3 SASI_Hs01_00132800 predicted 635
4 SASI_Hs01_00132801 predicted 482
5 SASI_Hs01_00132802 predicted 291
6 SASI_Hs01_00132803 predicted 417
7 SASI_Hs01_00132804 predicted 349
8 SASI_Hs01_00132805 predicted 573
9 SASI_Hs01_00132806 predicted 609
10 SASI_Hs01_00132807 predicted 646
11 SASI_Hs01_00132808 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001739
CA5A MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase VA, mitochondrial
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-888s1c1
Sequence:CCGGGTGAACAACTATCGCCCACTTCTCGAGAAGTGGGCGATAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-837s1c1
Sequence:CCGGGCATTTCGTACTCTCCTGTTTCTCGAGAAACAGGAGAGTACGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-902s1c1
Sequence:CCGGCCCACTTCAACCCTTGATGAACTCGAGTTCATCAAGGGTTGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-428s1c1
Sequence:CCGGCAGACTGAAGCAATTTCACTTCTCGAGAAGTGAAATTGCTTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-423s1c1
Sequence:CCGGCACTACAGACTGAAGCAATTTCTCGAGAAATTGCTTCAGTCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001739.1-567s21c1
Sequence:CCGGGTCGTGGGAGAGAATGGTTTGCTCGAGCAAACCATTCTCTCCCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001739
CA5A MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase VA, mitochondrial
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-888s1c1
Sequence:CCGGGTGAACAACTATCGCCCACTTCTCGAGAAGTGGGCGATAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-837s1c1
Sequence:CCGGGCATTTCGTACTCTCCTGTTTCTCGAGAAACAGGAGAGTACGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-902s1c1
Sequence:CCGGCCCACTTCAACCCTTGATGAACTCGAGTTCATCAAGGGTTGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-428s1c1
Sequence:CCGGCAGACTGAAGCAATTTCACTTCTCGAGAAGTGAAATTGCTTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-423s1c1
Sequence:CCGGCACTACAGACTGAAGCAATTTCTCGAGAAATTGCTTCAGTCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001739.1-567s21c1
Sequence:CCGGGTCGTGGGAGAGAATGGTTTGCTCGAGCAAACCATTCTCTCCCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001739
CA5A MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase VA, mitochondrial
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-888s1c1
Sequence:CCGGGTGAACAACTATCGCCCACTTCTCGAGAAGTGGGCGATAGTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-837s1c1
Sequence:CCGGGCATTTCGTACTCTCCTGTTTCTCGAGAAACAGGAGAGTACGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-902s1c1
Sequence:CCGGCCCACTTCAACCCTTGATGAACTCGAGTTCATCAAGGGTTGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-428s1c1
Sequence:CCGGCAGACTGAAGCAATTTCACTTCTCGAGAAGTGAAATTGCTTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001739.1-423s1c1
Sequence:CCGGCACTACAGACTGAAGCAATTTCTCGAGAAATTGCTTCAGTCTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001739.1-567s21c1
Sequence:CCGGGTCGTGGGAGAGAATGGTTTGCTCGAGCAAACCATTCTCTCCCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks