EMAIL THIS PAGE TO A FRIEND

CA6

carbonic anhydrase VI

29 Gene Product Result for
Synonyms: CA-VI GUSTIN
UniProtKB ID: P23280, E7EMQ1, Q5FBW3, Q5FC00, Q96QX8, Q9UF03
Gene ID:
Human(765) Summary: The protein encoded by this gene is one of several isozymes of carbonic anhydrase. This protein is found only in salivary glands and saliva and protein may play a role in the reversible hydratation of carbon dioxide though its function in saliva is unknown. [provided by RefSeq, Jul 2008]
Zebrafish(335151) carbonic anhydrase VI
cow(280742) carbonic anhydrase VI
Horse(100051818) carbonic anhydrase VI
domestic cat(101097328) carbonic anhydrase VI
dog(403503) carbonic anhydrase VI
chicken(428187) carbonic anhydrase VI
naked mole-rat(101707553) carbonic anhydrase VI
domestic guinea pig(100730364) carbonic anhydrase VI
sheep(101117861) carbonic anhydrase VI
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1307 Human CA6 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001215 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087551 MISSION® esiRNA esiRNA human CA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001215 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076842 predicted 893
2 SASI_Hs01_00076843 predicted 457
3 SASI_Hs01_00076844 predicted 786
4 SASI_Hs01_00076845 predicted 541
5 SASI_Hs01_00076846 predicted 444
6 SASI_Hs01_00076847 predicted 417
7 SASI_Hs01_00076848 predicted 690
8 SASI_Hs02_00331363 predicted 432
9 SASI_Hs02_00331364 predicted 905
10 SASI_Hs01_00076851 predicted 959
11 SASI_Hs01_00076849 predicted 442
12 SASI_Hs01_00076850 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001215
CA6 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase VI
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-756s1c1
Sequence:CCGGCTTACTGGATCACCGCAACAACTCGAGTTGTTGCGGTGATCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-841s1c1
Sequence:CCGGCCGAATCAGGAATACACTCTACTCGAGTAGAGTGTATTCCTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-505s1c1
Sequence:CCGGGAGGTGAAGAATTACCCTGAACTCGAGTTCAGGGTAATTCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-201s1c1
Sequence:CCGGGCTCAATATGACAGGCTATGACTCGAGTCATAGCCTGTCATATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001215.1-1152s1c1
Sequence:CCGGGTTAGACATCACCAGTGGAAACTCGAGTTTCCACTGGTGATGTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-411s1c1
Sequence:CCGGCGAGATTCACATTGTTCACTACTCGAGTAGTGAACAATGTGAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-733s1c1
Sequence:CCGGCAGGTTTGGAAGCTGGAGAATCTCGAGATTCTCCAGCTTCCAAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001215.1-1012s1c1
Sequence:CCGGGCACCCTACCTTGTCTAAGAACTCGAGTTCTTAGACAAGGTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-634s1c1
Sequence:CCGGCAGCACTACTACACCTACCATCTCGAGATGGTAGGTGTAGTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001215
CA6 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase VI
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-756s1c1
Sequence:CCGGCTTACTGGATCACCGCAACAACTCGAGTTGTTGCGGTGATCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-841s1c1
Sequence:CCGGCCGAATCAGGAATACACTCTACTCGAGTAGAGTGTATTCCTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-505s1c1
Sequence:CCGGGAGGTGAAGAATTACCCTGAACTCGAGTTCAGGGTAATTCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-201s1c1
Sequence:CCGGGCTCAATATGACAGGCTATGACTCGAGTCATAGCCTGTCATATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001215.1-1152s1c1
Sequence:CCGGGTTAGACATCACCAGTGGAAACTCGAGTTTCCACTGGTGATGTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-411s1c1
Sequence:CCGGCGAGATTCACATTGTTCACTACTCGAGTAGTGAACAATGTGAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-733s1c1
Sequence:CCGGCAGGTTTGGAAGCTGGAGAATCTCGAGATTCTCCAGCTTCCAAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001215.1-1012s1c1
Sequence:CCGGGCACCCTACCTTGTCTAAGAACTCGAGTTCTTAGACAAGGTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-634s1c1
Sequence:CCGGCAGCACTACTACACCTACCATCTCGAGATGGTAGGTGTAGTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001215
CA6 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase VI
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-756s1c1
Sequence:CCGGCTTACTGGATCACCGCAACAACTCGAGTTGTTGCGGTGATCCAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-841s1c1
Sequence:CCGGCCGAATCAGGAATACACTCTACTCGAGTAGAGTGTATTCCTGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-505s1c1
Sequence:CCGGGAGGTGAAGAATTACCCTGAACTCGAGTTCAGGGTAATTCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-201s1c1
Sequence:CCGGGCTCAATATGACAGGCTATGACTCGAGTCATAGCCTGTCATATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001215.1-1152s1c1
Sequence:CCGGGTTAGACATCACCAGTGGAAACTCGAGTTTCCACTGGTGATGTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-411s1c1
Sequence:CCGGCGAGATTCACATTGTTCACTACTCGAGTAGTGAACAATGTGAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001215.1-733s1c1
Sequence:CCGGCAGGTTTGGAAGCTGGAGAATCTCGAGATTCTCCAGCTTCCAAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001215.1-1012s1c1
Sequence:CCGGGCACCCTACCTTGTCTAAGAACTCGAGTTCTTAGACAAGGTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001215.1-634s1c1
Sequence:CCGGCAGCACTACTACACCTACCATCTCGAGATGGTAGGTGTAGTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks