EMAIL THIS PAGE TO A FRIEND

CA7

carbonic anhydrase VII

Synonyms: CAVII
UniProtKB ID: P43166, Q541F0, Q86YU0
Gene ID:
Human(766) Summary: Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. The cytosolic protein encoded by this gene is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
sheep(101104929) carbonic anhydrase VII
domestic guinea pig(100715522) carbonic anhydrase VII
naked mole-rat(101701928) carbonic anhydrase VII
Zebrafish(564201) carbonic anhydrase VII
chicken(415791) carbonic anhydrase VII
dog(489772) carbonic anhydrase VII
cow(520403) carbonic anhydrase VII
domestic cat(101086771) carbonic anhydrase VII
Gene Class: Dehydratase
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005182 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055541 MISSION® esiRNA esiRNA human CA7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014435 Rosetta Predictions human pricing
NM_005182 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231610 predicted 1168
2 SASI_Hs01_00231611 predicted 635
3 SASI_Hs01_00231612 predicted 1428
4 SASI_Hs01_00231613 predicted 531
5 SASI_Hs01_00231614 predicted 564
6 SASI_Hs01_00231615 predicted 731
7 SASI_Hs01_00231616 predicted 1076
8 SASI_Hs01_00231617 predicted 754
9 SASI_Hs01_00231618 predicted 881
10 SASI_Hs01_00231619 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212501 predicted 1011
2 SASI_Hs01_00212502 predicted 482
3 SASI_Hs01_00212503 predicted 1274
4 SASI_Hs01_00212504 predicted 372
5 SASI_Hs01_00212505 predicted 410
6 SASI_Hs01_00212506 predicted 575
7 SASI_Hs01_00212507 predicted 919
8 SASI_Hs01_00212508 predicted 600
9 SASI_Hs01_00212509 predicted 733
10 SASI_Hs01_00212510 predicted 865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005182
CA7 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase VII
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-654s1c1
Sequence:CCGGCTGCATCTCTGAAAGGCAGATCTCGAGATCTGCCTTTCAGAGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-82s1c1
Sequence:CCGGGATCGCCAATCACCCATCAATCTCGAGATTGATGGGTGATTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-87s1c1
Sequence:CCGGCCAATCACCCATCAATATCATCTCGAGATGATATTGATGGGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-720s1c1
Sequence:CCGGGATCCACATGGTGAACAACTTCTCGAGAAGTTGTTCACCATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005182.2-1273s1c1
Sequence:CCGGCAGAGAGACTCAAGCAATAATCTCGAGATTATTGCTTGAGTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005182.2-589s21c1
Sequence:CCGGTCGTCTGACAGATGCGCTCTACTCGAGTAGAGCGCATCTGTCAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005182
CA7 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase VII
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-654s1c1
Sequence:CCGGCTGCATCTCTGAAAGGCAGATCTCGAGATCTGCCTTTCAGAGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-82s1c1
Sequence:CCGGGATCGCCAATCACCCATCAATCTCGAGATTGATGGGTGATTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-87s1c1
Sequence:CCGGCCAATCACCCATCAATATCATCTCGAGATGATATTGATGGGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-720s1c1
Sequence:CCGGGATCCACATGGTGAACAACTTCTCGAGAAGTTGTTCACCATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005182.2-1273s1c1
Sequence:CCGGCAGAGAGACTCAAGCAATAATCTCGAGATTATTGCTTGAGTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005182.2-589s21c1
Sequence:CCGGTCGTCTGACAGATGCGCTCTACTCGAGTAGAGCGCATCTGTCAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005182
CA7 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase VII
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-654s1c1
Sequence:CCGGCTGCATCTCTGAAAGGCAGATCTCGAGATCTGCCTTTCAGAGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-82s1c1
Sequence:CCGGGATCGCCAATCACCCATCAATCTCGAGATTGATGGGTGATTGGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-87s1c1
Sequence:CCGGCCAATCACCCATCAATATCATCTCGAGATGATATTGATGGGTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005182.1-720s1c1
Sequence:CCGGGATCCACATGGTGAACAACTTCTCGAGAAGTTGTTCACCATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005182.2-1273s1c1
Sequence:CCGGCAGAGAGACTCAAGCAATAATCTCGAGATTATTGCTTGAGTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005182.2-589s21c1
Sequence:CCGGTCGTCTGACAGATGCGCTCTACTCGAGTAGAGCGCATCTGTCAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks