EMAIL THIS PAGE TO A FRIEND

CA8

carbonic anhydrase VIII

39 Gene Product Result for
Synonyms: CA-VIII CALS CAMRQ3 CARP
UniProtKB ID: P35219, A8K0A5, B3KQZ7, Q32MY2
Gene ID:
Human(767) Summary: The protein encoded by this gene was initially named CA-related protein because of sequence similarity to other known carbonic anhydrase genes. However, the gene product lacks carbonic anhydrase activity (i.e., the reversible hydration of carbon dioxide). The gene product continues to carry a carbonic anhydrase designation based on clear sequence identity to other members of the carbonic anhydrase gene family. The absence of CA8 gene transcription in the cerebellum of the lurcher mutant in mice with a neurologic defect suggests an important role for this acatalytic form. [provided by RefSeq, Jul 2008]
naked mole-rat(101698431) carbonic anhydrase VIII
domestic guinea pig(100727646) carbonic anhydrase VIII
sheep(101110343) carbonic anhydrase VIII
Zebrafish(550233) carbonic anhydrase VIII
cow(515918) carbonic anhydrase VIII
chicken(421139) carbonic anhydrase VIII
domestic cat(101083483) carbonic anhydrase VIII
dog(486965) carbonic anhydrase VIII
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42166 Anti-CA8 antibody produced in rabbit IgG fraction of antiserum human, rat, guinea pig, horse, canine, mouse, bovine, zebrafish, rabbit
western blot pricing
HPA024748 Anti-CA8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry, western blot pricing
SAB2100327 Anti-CA8 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, zebrafish, rat, mouse, horse, bovine, human
western blot pricing
WH0000767M1 Monoclonal Anti-CA8 antibody produced in mouse clone 1F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H4759 Hydrochlorothiazide crystalline human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1309 Human CA8 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004056 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056481 MISSION® esiRNA esiRNA human CA8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004056 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140821 predicted 1074
2 SASI_Hs01_00140822 predicted 882
3 SASI_Hs01_00140823 predicted 788
4 SASI_Hs01_00140824 predicted 689
5 SASI_Hs01_00140826 predicted 1311
6 SASI_Hs02_00336827 predicted 944
7 SASI_Hs02_00336828 predicted 791
8 SASI_Hs01_00140828 predicted 1076
9 SASI_Hs01_00140829 predicted 748
10 SASI_Hs01_00140830 predicted 893
11 SASI_Hs01_00140825 predicted 1359
12 SASI_Hs01_00140827 predicted 1087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004056
CA8 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase VIII
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004056.4-504s21c1
Sequence:CCGGGGACATACCATTCAGGTTATCCTCGAGGATAACCTGAATGGTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004056.4-1159s21c1
Sequence:CCGGGGAAGACAATGGTCCTATAATCTCGAGATTATAGGACCATTGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-480s1c1
Sequence:CCGGCGAGACTGTGAAGTCACCAATCTCGAGATTGGTGACTTCACAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-885s1c1
Sequence:CCGGCGGGATTACTGGGTGTATGAACTCGAGTTCATACACCCAGTAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-738s1c1
Sequence:CCGGGCCATCATTGCTCTGTTTGTTCTCGAGAACAAACAGAGCAATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-941s1c1
Sequence:CCGGCACCTGGATATTATTCCGATACTCGAGTATCGGAATAATATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004056.3-579s1c1
Sequence:CCGGGAACTGTACGAAGTGAGATTTCTCGAGAAATCTCACTTCGTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-392s1c1
Sequence:CCGGCCAGTCTCCTATTAACCTAAACTCGAGTTTAGGTTAATAGGAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004056.3-561s1c1
Sequence:CCGGCCTCAAGGGCATGAGTTTGAACTCGAGTTCAAACTCATGCCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004056
CA8 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase VIII
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004056.4-504s21c1
Sequence:CCGGGGACATACCATTCAGGTTATCCTCGAGGATAACCTGAATGGTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004056.4-1159s21c1
Sequence:CCGGGGAAGACAATGGTCCTATAATCTCGAGATTATAGGACCATTGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-480s1c1
Sequence:CCGGCGAGACTGTGAAGTCACCAATCTCGAGATTGGTGACTTCACAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-885s1c1
Sequence:CCGGCGGGATTACTGGGTGTATGAACTCGAGTTCATACACCCAGTAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-738s1c1
Sequence:CCGGGCCATCATTGCTCTGTTTGTTCTCGAGAACAAACAGAGCAATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-941s1c1
Sequence:CCGGCACCTGGATATTATTCCGATACTCGAGTATCGGAATAATATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004056.3-579s1c1
Sequence:CCGGGAACTGTACGAAGTGAGATTTCTCGAGAAATCTCACTTCGTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-392s1c1
Sequence:CCGGCCAGTCTCCTATTAACCTAAACTCGAGTTTAGGTTAATAGGAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004056.3-561s1c1
Sequence:CCGGCCTCAAGGGCATGAGTTTGAACTCGAGTTCAAACTCATGCCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004056
CA8 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase VIII
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004056.4-504s21c1
Sequence:CCGGGGACATACCATTCAGGTTATCCTCGAGGATAACCTGAATGGTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004056.4-1159s21c1
Sequence:CCGGGGAAGACAATGGTCCTATAATCTCGAGATTATAGGACCATTGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-480s1c1
Sequence:CCGGCGAGACTGTGAAGTCACCAATCTCGAGATTGGTGACTTCACAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-885s1c1
Sequence:CCGGCGGGATTACTGGGTGTATGAACTCGAGTTCATACACCCAGTAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-738s1c1
Sequence:CCGGGCCATCATTGCTCTGTTTGTTCTCGAGAACAAACAGAGCAATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-941s1c1
Sequence:CCGGCACCTGGATATTATTCCGATACTCGAGTATCGGAATAATATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004056.3-579s1c1
Sequence:CCGGGAACTGTACGAAGTGAGATTTCTCGAGAAATCTCACTTCGTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004056.3-392s1c1
Sequence:CCGGCCAGTCTCCTATTAACCTAAACTCGAGTTTAGGTTAATAGGAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004056.3-561s1c1
Sequence:CCGGCCTCAAGGGCATGAGTTTGAACTCGAGTTCAAACTCATGCCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks