EMAIL THIS PAGE TO A FRIEND

CA9

carbonic anhydrase IX

56 Gene Product Result for
Synonyms: CAIX MN
UniProtKB ID: Q16790, Q5T4R1
Gene ID:
Human(768) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and the only tumor-associated carbonic anhydrase isoenzyme known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jul 2008]
naked mole-rat(101722784) carbonic anhydrase IX
domestic guinea pig(100729644) carbonic anhydrase IX
sheep(101115682) carbonic anhydrase IX
Zebrafish(566612) carbonic anhydrase IX
cow(511923) carbonic anhydrase IX
Horse(100055579) carbonic anhydrase IX
domestic cat(101092802) carbonic anhydrase IX
dog(611933) carbonic anhydrase IX
chicken(770004) carbonic anhydrase IX
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001216 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037121 MISSION® esiRNA esiRNA human CA9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001216 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214201 predicted 1084
2 SASI_Hs02_00331365 predicted 1139
3 SASI_Hs02_00331366 predicted 908
4 SASI_Hs01_00214206 predicted 992
5 SASI_Hs01_00214207 predicted 851
6 SASI_Hs02_00331367 predicted 1142
7 SASI_Hs01_00214208 predicted 895
8 SASI_Hs01_00214209 predicted 606
9 SASI_Hs02_00331368 predicted 759
10 SASI_Hs02_00331369 predicted 768
11 SASI_Hs01_00214202 predicted 1278
12 SASI_Hs01_00214203 predicted 1055
13 SASI_Hs01_00214204 predicted 1055
14 SASI_Hs01_00214205 predicted 1178
15 SASI_Hs01_00214210 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001216
CA9 MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase IX
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-328s1c1
Sequence:CCGGCCTGAAGTTAAGCCTAAATCACTCGAGTGATTTAGGCTTAACTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-325s1c1
Sequence:CCGGCTACCTGAAGTTAAGCCTAAACTCGAGTTTAGGCTTAACTTCAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-1005s1c1
Sequence:CCGGCAGCCGCTACTTCCAATATGACTCGAGTCATATTGGAAGTAGCGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-420s1c1
Sequence:CCGGGAATAATGCCCACAGGGACAACTCGAGTTGTCCCTGTGGGCATTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-376s1c1
Sequence:CCGGGATCTACCTACTGTTGAGGCTCTCGAGAGCCTCAACAGTAGGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-376s21c1
Sequence:CCGGGATCTACCTACTGTTGAGGCTCTCGAGAGCCTCAACAGTAGGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-1005s21c1
Sequence:CCGGCAGCCGCTACTTCCAATATGACTCGAGTCATATTGGAAGTAGCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-325s21c1
Sequence:CCGGCTACCTGAAGTTAAGCCTAAACTCGAGTTTAGGCTTAACTTCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-420s21c1
Sequence:CCGGGAATAATGCCCACAGGGACAACTCGAGTTGTCCCTGTGGGCATTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001216
CA9 MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase IX
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-328s1c1
Sequence:CCGGCCTGAAGTTAAGCCTAAATCACTCGAGTGATTTAGGCTTAACTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-325s1c1
Sequence:CCGGCTACCTGAAGTTAAGCCTAAACTCGAGTTTAGGCTTAACTTCAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-1005s1c1
Sequence:CCGGCAGCCGCTACTTCCAATATGACTCGAGTCATATTGGAAGTAGCGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-420s1c1
Sequence:CCGGGAATAATGCCCACAGGGACAACTCGAGTTGTCCCTGTGGGCATTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-376s1c1
Sequence:CCGGGATCTACCTACTGTTGAGGCTCTCGAGAGCCTCAACAGTAGGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-376s21c1
Sequence:CCGGGATCTACCTACTGTTGAGGCTCTCGAGAGCCTCAACAGTAGGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-1005s21c1
Sequence:CCGGCAGCCGCTACTTCCAATATGACTCGAGTCATATTGGAAGTAGCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-325s21c1
Sequence:CCGGCTACCTGAAGTTAAGCCTAAACTCGAGTTTAGGCTTAACTTCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-420s21c1
Sequence:CCGGGAATAATGCCCACAGGGACAACTCGAGTTGTCCCTGTGGGCATTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001216
CA9 MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase IX
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-328s1c1
Sequence:CCGGCCTGAAGTTAAGCCTAAATCACTCGAGTGATTTAGGCTTAACTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-325s1c1
Sequence:CCGGCTACCTGAAGTTAAGCCTAAACTCGAGTTTAGGCTTAACTTCAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-1005s1c1
Sequence:CCGGCAGCCGCTACTTCCAATATGACTCGAGTCATATTGGAAGTAGCGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-420s1c1
Sequence:CCGGGAATAATGCCCACAGGGACAACTCGAGTTGTCCCTGTGGGCATTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001216.1-376s1c1
Sequence:CCGGGATCTACCTACTGTTGAGGCTCTCGAGAGCCTCAACAGTAGGTAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-376s21c1
Sequence:CCGGGATCTACCTACTGTTGAGGCTCTCGAGAGCCTCAACAGTAGGTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-1005s21c1
Sequence:CCGGCAGCCGCTACTTCCAATATGACTCGAGTCATATTGGAAGTAGCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-325s21c1
Sequence:CCGGCTACCTGAAGTTAAGCCTAAACTCGAGTTTAGGCTTAACTTCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001216.2-420s21c1
Sequence:CCGGGAATAATGCCCACAGGGACAACTCGAGTTGTCCCTGTGGGCATTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)